Description :
From Genome Similarity Track
Location :
Scaffold_361:30- 1069
Transcript NameFunction/comments
g5150.t1XP_009533004.1 hypothetical protein PHYSODRAFT_337084 [Phytophthora sojae

Sequence
1039 bases(100 bases per row)
ATGGACTTTGTTTTTGGTCTTCCGCAGACAACAACGGAGGAACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACC
AGCCGAGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACAGTGGTGTTTAGACACCATGGTACTGCACTCGACATCGTGTCGGATCGGGATCCGGCT
TTACAGCGCGATTCTGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTTCGACTGCGGATCACCCGCAGACGACGGACAAACAGAGCGTGTC
ACACCGCGGTGCTGTTGACACTTGGTCACATGAAGAGCTACGCGCACCTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGGCGGAGTCGCCATCACAA
CTCGTGGCATGCTTTCGACAGGACACACACCGTTCTACGTGAATGCGCATGAGGCACCCACGCTACGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGT
GGGGGAGGGTATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATG
GCGTCGACAACGCAGTGTCTACGACGGACGTAGACACTTTAAACCACAACGGACGTCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAA
CCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAACCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAG
CTGAATGCCGATAACATCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCGTTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCG
ATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTATTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCG
CTTGCACCCAACGTTTTACGTTGGCCGACTGAAGCCGTA