Description :
From Genome Similarity Track
Location :
Scaffold_420:3- 7969
Transcript NameFunction/comments
Phyin_T30-4PITG_21762Putative uncharacterized protein
Phyin_T30-4PITG_21763Putative uncharacterized protein
Phyin_T30-4PITG_21764Caltractin
Phyin_T30-4PITG_21765Putative uncharacterized protein
Phyin_T30-4PITG_21766Putative uncharacterized protein
Phyin_T30-4PITG_21767Putative uncharacterized protein

Sequence
7966 bases(100 bases per row)
TTCTTACGGCTCTGTGTATAGCAGATTGAGACTGACCACGACATTCTCTCTCATACCAGTGATGGCACGGCTAGCAGAGGCCCCCCGGACAGCACACACA
GTAACATGAGCGTGCTGGATCTGCATCAGCTCGAGAAACCTGTTCATGAAGAGGATGAGTGGCCTCAGAAGCCTCTAGCGCAGCCACTGAAGCTCGACGC
GTGGACGTCTAAGGCACAACGTGAGCAAGAAACGTTCCATCGATACGTTGAAAAACATGGCCCTGATATCTGGAGCACTGTGTGGAACGGTATCTGGACA
GGTGGCGACGTCAAAGAAGTGCAAGATGAAGACGGCGAAGTCATCATGACGGTGTAGAATCAAAGGTCAGTTGGGTGAATGAATTGAGTGCCTAAAGATG
CAGATCTAGCGGATCGGAGAACCAGCAGCGGTGGTAACGTCTTGCTGTTGCTGTTTGTACACACTAGTGAGGAGTTTTTCACGCTTTTTAGGCTGCTTGT
ACAGCGCGCAATTGTTAGCACACGGCTGCGTCGACCCGGTCTTAGCACACGAACAGAGAGCTGGAGTTCCGAGTTGCGCTTGCAGAGCTCGCAGGAAACG
CTCATGCTCTCTCGTTGTTGATTGAACTTTGTTGCCCTTTGCAGCCTTTTTTCTCCATGGCGTGGATGATGTGGTGGTTTGACGATGCACTCGAACGTCA
CAGCCCGACGTCATATCGATACTGCGAAGAAAATTTGCCACGTTGGATAAAAGTACAAACAGATCGAGTGGCTTACGTACACTGTAACTCCAGTAGAAGT
CGTACTGCCGTGTTCTTTAATGCTATCGTCTGAATTGTCGCGAGTTCGCCTGCTTCGACCAGCTGTTGGAGATTTAGACACCGGACACTTCTTGTTTGTT
TGAGAATCTTCTCGCCAGTCGCTTTTAACTTGAGCACGATTCATTTCCATGTATTGCCGGCGCACTGTTGCGTACAGAGCAACACGCTGCAACACAGAAG
GAAGCGATAAGCATATATCTCAAGCATACTGACAAAGTTACGTACCTGTTCGGGGAGCAAAGCTGGTGCTACAGCCGACTCGCTTATAACTTGACCTTCA
TCACTCCCATATTCGTCGTTGTTGGATATTTTTTGATAGCTCGAAGGTTCAGTAGATCGCAGTAGATCATCTCGGATCTTGGCATCTAAACGCAACATCT
AATACCACATTTTCACAGCGATGAAGAGAGGGAATGCTTGACTGTCACCGACCGTTTCTTACCTTTTCAATGTGTTTTCCTAACGGGCAATCCTGGAATG
AATAGGCAACAAGAAAACTTTAATTGCCACGCCACAGACACAGCATGGTAATTCGTCTGACAAACCTTGAGAATGGCTTTCTTGTCTTTTATCAATTTCT
GAAAGTACGGACGAGTTGAAAGTCGTGTGGCCACAGAGTTCCCAGTTGGCTGTGTCTGCACTGTAGTTGAAAACACTTTTGCACACTTCGCATCCTACAC
GAACCCATCAAGTCAGATTATAGATTCACTATAAAAGTTAGAAAACTTCATGAATATCACTCACCAAATTCTTCTGCGCGCGCTGGGCTTCAAGTCGATT
TTGACGTTCTCGCTCCGTCACGCGCTGACAAATTTTGTCATGGAATCGTTTTAGCTCGTTCGACTGGGCACGCAGCCGAACTTCGGCTGCGTGACGCATT
GACTCCGTTTCAGCCTGATCATTAACCGCTCAGCTTTTGCTTTTACAGCTTTCGTAAGAACTCACTGAACGCTTACCTCCACATCAACCATACCGAGATC
GTGCCAGTGATCATCCTCATCAATGTATCTGTAATTTCCAACGCTGCAGCTCTCAGAACAATTTGTTACAAATAAAATAACAGCAACCTTTATCTTACTC
ATCGTCTGACGAGTGCGAAACTGCTACCTCTCCAGCTAAAATGTAGGCTAAACCACTCAACAACAAAAAAGCACCACTGTTATGATCTGGTGTATCGTAA
ACGAGAATGACATGCGAGCGCACCATTTATTGGCGGGATGACTGTGTCCTCTCCAGCAAATCCATTCATTTTCGAATAGAAAGAGAGATCCGCAAGTGTT
CTCGAAAAGACGCATTTCCAGAACATGGCTACACTTGAAAGGGCGTACGTACAGTGATCGACAGGATCCCGGGACGACAGGAGATCTACATGCGTTTGAC
ACAGTTTTACCATGTGCGCGATCCCATGGAAAACCTGCTTGTTGGCGTGACCTTGCGCAAGGTGTGGTAAGGATATCATTTTAAGGAAAGTCGTTTGTAG
AATCTTATAAGTGCAAGGAATTGTAGATCTCGGGATTTGGAAGCGATAACTCAGTACCGGTAGGGAAAACGTGGACGTACAGCTTTCAGTGGCAAGAAAA
AAAGCTCAGTATAAGGTATGTCTATCTCATTGAGCGATATAAAGGATAGTGGGGTTGCAGTACTAAACGTTTATGGGGTCGCTCAAGCGAGAAGAAGCGA
GAGCTGGATCGTCTCGAAGCAGGAGAAATCCTTCGAAAAGTACGATAGCTACAGAATTTTTGTTTTTGTGTACCCTCTGATGAATTTAGTTTTTATAATT
ATATTCTAGCGTCAAGATGAAGAACCACTTGAGAGTGGCAACGCCGACGTTTTGTATTCATACGTCGATGTTGATGATTTTATTCCCGAGGAGGTATGTG
CGTTGAAGAAGTTTTTACATTGTGCGGCGAGTTTTTTTTATCGATCCACCGACTACAAACCACGCAGTATGCAAAAGACCCGCCAACTACTTCGAAAAGT
AGCGTGACGCATCTCATTCCCCCAGATCTTACGCGACGACCTCGGGACAAGCGGCTTGAAGCTTCGTGGACGTCCAATCAACACCGTGCTTGGCTTCGAG
CCAACCGCGAAGATGAATTTCGTGCCATGCACATTGTTGCTCTTATCGAAGGCGTCGAGCGTGTACTTTGCTCTCTTCGATTCTACAAGGAGACTGGATT
ATTCTGTGCTACACCAGGGTTTTCGGCACCAATCGTCGATCCAGAAAATGACCCAGATCTACTTATCAAAGGCCCCAAGCTGTCGACGTACCATATATCG
ACTCCTGGCGGCTCACTCTATGAGTATGTGCTAGACAGCATGCATGACCTTCTTCCGCTTGCTTCTTCCGAAGACCAAAGACTTTCTCGAGACATTCGCT
TGCAAGAGGAGAAGCGCGACTTTGCGGAGGTGTCTCGATGGCAGCTACTGAGTCAGGATCCAAAGTTATCCGAAGCAAAAAGTGTTGACTGCAATATGCA
GCGGAAGATGATGATATCGCTGGAAGTGGCTGCGGTCGATAATCCGCAAACAACTGACTCGATCTTTGTGGAGTATGAGCTTGAGCTACCCGGTCGTGCT
GGACACTCTCAGTGGAAATTACAGCCTGGTAATTATACTAGGAAGCGTGGCAAAACCCCGTTATCGTTACATCAGCGGTCCGAGTATCCTGGGTGTTTGA
CTTCCGTAGCGTTTGGGTGGCATCAGCACTTCAATCTGAAACTTGTTAAGGATGAAGCATTAAATGGCGCAGACGAGGGGGATGACGACATTGTTCCGTG
TCCAGTCCTCCACTTAAGCGTGTATTCTCGAGATTCGTGGCGAAGGAAAAGAACACAAGGCCATGGTGAGATAAAACTAGGGAATTGCTCCGGATTTTAC
GATTCCGACGTTCCTATTCGCAAACCGATTACCTCCATTAGTGACCGGATGGAAGAACTCTTTCTGGGCATCGATGAAAGTATTGAAGATGTCGAGCTCA
CAAGAGGTCAATTGCGGGAGGTTAATACCGACGATTCTCCTTTATCCACCATGATTACGAGTCGACTAGGACAGAAATCGGAATCCACTGGCACAACGGT
TCGAGTTCGCTGCAACATCGTCGACCTACAGCCATCGAAGCATCCTAGTATTGGACGGCTATCGTCTGCACCAATGACTACATCCGTAACAAATACTCGC
ATTGTAAAGCGAAGCGTCCAAGAAATTCTGCAATCGGTTAAATTAGAAAAACGACTAGCGAGTATAACAGACCCCCGTATTCAGGCGGCACTGCGCTCAC
TACCAATAGACAAAAGTGATCTTGTTTAGAACCCTTAGTTAGCCTAATGTATTGGGAGGAATCAGTCATCATCGCTGTCTAGATCGTCCAGAGGGTTACC
GCTACGCTTCTTCATGACGCGAAAAAACTCCTCTTCGTTGATGAAGCCGTCTCCGTCGTGGTCGGCTTCATCGATCATCTCCTGCATCTCTTCGTCCGTC
AGATTTTCTCCCAGCTCGGTGCACACGCGCTTCAAGTTTCGGAACGAGATTTTGCCCGTGTTGTCGTCGTCAAAGAGCTGGAAGATCTTCATAATTTCCT
CACGCGAGTCTCGCGAGTTCTAGATCGATATAAATACAAACACAATGAGCTAATTCTTCGTGTTGCCGCTTTTGTTTGTCCTTTTCCAGTGCAGCTTACC
ATTTTCCCGGTCATCATCTCGATAAACTCGTCCAAGTTGATCGTCCCCGACTCGTCCTTGTCAATGTCGGCGATCATCTGGCGGATCTCCGCCTTCTTCA
CTTGGAAGCCAAGCGCTCGCATCGCAGCCTTCAGCTCGCGCACGTCAATGCTGCCACTGCCGTCCGTATCGAAGAGATGGAAAGCCTCCTTGATCTCCTC
TAAATCCTCTTCGTCCAATACCTTTTTCACCGGTTTAGGCTTGCGTCGCAGAGCCGCACGAGATCGCGCGAAAGCTGAAGCGGACATGGCACTCGACTGC
AGCAGACACAGCAATTAGCACATTCATATCGTCCACGTTGCGAGGCCTCCAGCAGCTTACACGTTCCATCCCTCCTTGGTGCAGAATGCAAAGTGTCCGT
TACTTCAGATTACGACCTTTCAGATCGCACTTCAACATGGCATAGATTTATGGATCTAGAATATCTCAGGATTTGTTACTTTTCAGAAATCGGACAGTTT
CTAAACATTAGAATTTTGGTTTACTCTAAATTCTGAAGATCGCGTACTATTTTCGTGACACTTGCGTAAAGTATCACTCTTCAGCAACCAGTTAGCGAGT
TCTCCCACTACATGACAATGCTGGGTGCCGCGTCGAAGCGCATGCGTCTAAGCACGATGCGCACGCTGAAGGCTTACGACAAGAGCGAGCACCGCGTGCT
GGTCATCGGCGGCAACGGCTTCGTGGGCAGCAACATCTTGCAACGCGCCGTACAAAAAGGAATCGAAGTGCGCAGCCTCAACCCGTCGGGCAAGCCGCAA
TGGCAGGACGTGCCCTGGATCGACCAGGTGGACTGGCACGAGGGCGACGTGTTCGACGAGAAGCAACTGGCAAAGGCAGTGGAGGGCGTCACGGGCGTCA
GTACGTTTAGTGGAAGAGCGCGTTGAAGATGATCGTGTACTGACTTTAGGGCTTTGGATCACAGTCTCGACGGTGGGTGCGTTCGGCAGCAATGAGCTCA
TGGAGAAAGTGTGCGGAGACGCTACGATTGTGGCGGCGAGGGCAGCACAGAAAGCGGGAGCGGAGCGCTTCGTGTTCGTCTCCAACTCGCGCGTAGGCTC
GTACTACCCGTCGTGGCTGCCTATGTATGGCTATTACCATGGCAAGCAGAGAGCCGAAAAAGCTGTGCAGTCGAGGTGACGCAGAGAAAACGTTTAGGCT
TTTTACTTTGCTGCTAACTACTGTATTGTATTGGTTTTAGATTCCCCAGCACAGGCGTGGCGCTGCGTCCGGGTTTCATCTACGGCTGGAGACGCACTAT
AAAGGGTCGAGGGATTCCGCTGCAACTTGCAGGGGCGCCAATGTCACTGCTGGCGAGAGACCTTGGTGCAGTTTCAACTGCTCTAAGCTACATGCCGTTC
TTTGGAGAGGAAATGCGAGCTGCGATTCCTGTTGGTGTAGTCGCAAAAGCTGCTGTGCTCAATGCGATTGGTCCAGTCCACGGACACACGTTGGATACGA
CCAGTATGCTGGAGTTGGCTGCGTCATTCCACATCCACGAGGAACAAGATTAACGATGAAAAAATGAGTCGAGCACAAATTCGGAAGTGATAAATCTAAC
ATTCCTCGCGGCAATAATTATCAAGCTCCTTGTGGCTTCTACTGCTTTACTCTATCTGTTGGCCATCGCTTGGGCTGTGTATTTCATTCCTATAACGCCA
ATCTTCTTCTTGCGTTCCTCAGCTTCACGCCGTCGCTTCTCCAGTTCGTCCGTTCGATCTTTCCAGTATTGCTGTCACATAACTAGATCGTCAGATAGAG
TTCTAGAGACCGGAACTTTTAAGACTTGCACCTCTTTTTGCTTCTCTTGCTGTTTCTCCAGTTTTTCCTTTAAGCTTTTGGAATCCTCCTCACATCGTTC
TGCTTGGTCGGCTAGACACAGCTCTTCCAACGTCTGCACCCAGAGATCTCGGACAGTCGTCGTTTCTGCTGTCAGCTCAAGCAATTTCTGCCCACTTTGT
CCGAGAAGCACCAGGTCAAGACGACCTGCACAAGACCCAGTGCATTAGAACTCCTGCAAGTGCTTGGTGTAAACGTCGACGTACCCATCGGACATACTTT
GCCAATCCTGTAAACTGGCAACTCTTCAGAGCTACTTGGACCGGGTGTTTGTCGCCACATCAGCCTGCCACGAAGAAGCAAATTGCATTAGACTGGTTGT
TTGCAAATCTGATTTATAAAAAAGAATATCACCTTGCACCCGCAGAATTTAGCTGCAAGTGGACGTTTTCAGTACGACTGAGTACCCCAAGGAAAGCGCT
CTTTTTCTTGAAATCGTTTCCTTCTTTGAGCAGCTCCTGCCGAGCCAGCATCTCTGAGTTACCACCGCCGCAGCACACGTTGCCCATGGTCACCGCAAGT
GTTGTCTTTTTTTTAAAGGCACCAACCCAAAATACTACAGTAAAAACGACTACCAGAATGTCTCGCCAATTTGCTGATGTTTGACAACAAAACAAACGAT
CAACATGTATTTGTTTCTCAAAAGATTTGAGAAATTGGAAAATGTAAACGACAATGGGCAGCTTCTCTCGCTACTTCTTTCTACGACACTGGCTACCAGC
GGACAAATAGCGAAGAGTCTTCCACGTCTAACGACGCAGAGTTCTCTTGACAGCACAACCGCCACCGGAAGTCGGGGTGGAGCTTGAACCCCAAGGAGAG
CGCTTGGTGGCATCACCAGCTCCACTCGGCGAGCTACTGCTGGTGGGTCCTGCGGATCCTTCACTGCCTTCGGTGTCGGCGCTGCCGGTAGTGTCGGTAC
TGGCTCCAGTGTTAGAGCTCTCAGTAGTGCCGGTGGCACCTCCACCCTTGGTCGCGTCAGCAGCTCCATCATCAGAGCTCTCGGTGGTGTCTTCAGCCCC
GCCCTTTGTCGCGTTTGCAGCTCCAGTGTCAGAGGTTGCGGTGGTGTCATCAGCCCCGCCCTTGGTAGCGTTAGCAGCTCCATCATCAGAGCTCGCTGGA
GAGCCTCCCCTCGTAGCGTCAGAGGCTCCAGACGCACCAGCCGCCGAGGAAGTTCCGCTTGCACCACCTTTCGAGGCGCAAGTCGTGGCCTTTCCGGGTG
TAGTCGTGAAAGCAGTCACCGTGAAGTCCGGTTTACCGCCCTTCTTCCACGTGCAGCATGGGTCACCGAAAGCGGCACCATTGGTCATGCTCGAGCCAGG
AAACTTGGCCTCACACAGACTTTTGGACCACGTGTGACCGGCGGCAGCAAACGCTTTAGCAAAATCCGTCGTCTTGGAGCTGTCGCTGCCAGGGTGTCCG
AGAGGTTGCTGGAAGAGACTGCCGTTCGGGAGTTCGTCGAGGTACTTGGCGAGGGCGTAAGCCGAGTCCATCGTCGCAGCGATGGTCAAAGCAGCGGTAG
CGATGAATACTTGAGTCTTCATTCTAGCGGTCTTGCGTTAATTCCGGAGGTGTTGGTTTTGGTGGT