Description :
From Genome Similarity Track
Location :
Scaffold_1051:3- 6185
Sequence
6182 bases(100 bases per row)
CCCACTTTAACGACGAAAGGATGAGGGATCCACTGCTTCTCGCCGGATACATCTCGGATCATTCACGGAGACAATGGGGATCGATCTCTCTGTCTGCCAG
GGGGAGCAGTGTTTGGACTTCCCGACCCAGCCGTGCTTAGGAAATGCTGCGGGCCTTTGCTCCGCCGAACCCCCGCTAGAAGAAGGCGGGCGGTTGGATC
CGGCACTTTCCCCCAAAAGGCTCCGAGCCCTACGCCCCCAGCTCGTACGTGTCCAGCAAGTCAAGGAGTCCGACTCAGGAACCTGAATCAGGATCCGACG
GTTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGCCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGACCGGTGGATTCTGT
ACCCGGGGAGCGTGGGATGTACATCGTAGCTGGTGTGCTCGACGCAGAGGATATCTTCGAGCTAGCCCTGGATCTCATAGTATCCGCGACGCGGGACCTC
TTTGCCAGAGTTAAGGCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTTGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACGAATCCG
CCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACA
GGAAGCCCCTGTGAGCGTGAAGGCTCGGGATCCAGTAGGCCCTACGCGTGATCGGACACAATCCAGCCAGGATCGAGCCAGATCCGGCATGGAGCCAGTG
GGACTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGGCCAGACGGCCACAGGCTATTCCGACACACCCTGCAGCAAAA
CTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTTCACGAACATGGAGCACGAGACGTGGAG
ATGGAGTCCGTGGAGGGAGACAACTCCCATAATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCG
GGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAAC
ATGGATCAGCAAAGTCAAGTCGTCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAAC
TGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGATGGCACGAA
AATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGG
GGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGGTGGGAGACGTGAATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCA
GACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGC
CTACGGCCCCAGCTCGACGTGTCGACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCG
GGTCTGTCTCACTGCGTCCAACGACCGAACGGCGAAGACAGGAGTCAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGA
GTCTTCATGGACGGGGCAGCACAAGTCAGGTGATCACAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTG
GCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAAAATTCTACAACCA
GATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTAC
GAGCCGAGCGCTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGAGTCGATAATACACGTGATCTACATGAAGTGT
CAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGAGGAGAGGCACGTGGTTATTG
GGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGAATCCCGTGGATCTGAG
GATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGAT
CAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGT
CGGATCCAAGACTGTGTTGGGGATTGGTGAAGGCGTGAACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTT
GACATCTGGGTTGGAGATCTCGCTGGCCAAGATGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTT
GTTTCCCTGACGAGATGCGGATCCAGCTCAGCGAACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATCGAGCC
CGGAGAAACCTGGGAACTGCCAGATCGGTTAAAGTGGGTGGAACATGAGAAACGGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGA
CCAGGTCGATCGCAATACCTCCAGGTCATGAACGTCAGCGACAAGAGACTATTACTGGACCACTATGAAGAGATCGGACGATGGTTGGCGAAGGATAGTA
TCCCTAAGCGACCTGGATATGTGTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGA
GGAGGGGTCCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATACCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTCGAGATCCAA
GCAATGGAGGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGAATAAAGGATTGCAGAGGGCTAAAGCCGAAC
AGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGAGAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAATCGTC
GGGTTTAAGCTCGTTAGAGGACCGACTAGATCCGACCGGTGACTTTCCCAGTACCAGGATACCCGACCCCACGAAGACAGAAGGGATGACGGTCGAAGGA
GAGTCGCGGTGCCTGGATCCAAGGGTGGATCAGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAG
AAGGCATGGCGGTGACCCCGGAGGTACCACTGACCACAGAAGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGACGAATGAAGCTGCTGAAGTGGA
TCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTC
GGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGCGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTAATTAAGGGCCTGCTGCAAGCCAAGATCA
TCAGTTTCTTAACGTCCCCGTGGGCATCCCCAGCGGTATTCATCATCAAGAAGAACGGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACG
GTCTGACTCGATTGATGGTGTATCCGATGTCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACGGCTCTCTTGACATGGCCAGCGG
TTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAG
AACGCACCCCAGATCTACCAGCGTCTAATCGATAACGCCCTCTATGGATTCACCGGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAAATCATACGG
AAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATC
GTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTATAGGGGAATCTCTCTATCAGTGTGGGAAAGAGCTATTGAGGAATGCGCAA
GGTGGATTACTTAGGCCATCGAGTTTCTAAGGAGGGATTGGAGACGAATCCTAAGGACCTGTCTTCGTTAGACGATTTGTCCTTCCCGCAGTCGTTACGG
GCGATGCAATCCTTCTTGGGCAGTTTGAACTATTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTTTATGAATTGAGAGAGGTAGATT
TTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGGTCCACGAAGGGATCCAAGTGGTACGACGCCAGA
AGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCT
CGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTAA
TAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAA
TGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTG
ACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTAGACGCTGGAGATTG
TGAAATGCTCGAAAGGGGAAGACGAGATCCTGGTAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAA
AAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGC
GGAGGCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTACTACGGGCCAGATCCACTTATGCGGAAGCCTCACCGTCAACGAAGCGGA
GTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGGATTCAATTTGGGGGATCAGACAGGTGCG
AGGTGAGATTGACTGCAAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAA
GCGAGATTGGAATGCCAGTGCAAATAGTTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTT
ACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAG