Description :
From Genome Similarity Track
Location :
Scaffold_435:3- 5583
Sequence
5580 bases(100 bases per row)
ACCTTGAGGAGCTCGCTATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTT
GAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCG
GTGTACCCCTTGGTGAAGGCGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGC
TGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAAGCAGGCATGGT
GCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCG
ACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGTACGCTGTATAGCGCGCTGGACCTGGTGGACGAATACTACCAGATC
CTGATGCGCGAGAGGGACATCCCATTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGG
CAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGG
CCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGATGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCA
GCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCTGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGT
CACAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAA
GAACGATGTCGACTGGCGCTGGGAGCGTCGCCATCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGA
CGAGACGAAGCCTTTTAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGCCATCTCG
TTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACC
TCGTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGCCTGTC
ATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCTGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCAT
ATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGAACCTCTTGTACGGTTCTTGGCCGCTGGCTCGG
AAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGATGGCTTGCTCCACTATAGGGTCGAGCCCGAGGATCC
TCCCCGTATTGTCGTGCCCAACGACGAGAATATCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCGGTGGCCATCTCGGCCGTGAGAAGACG
TACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCG
GTCACGCCTCAGCACCATTGCAAAGCCTGCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGG
CAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTC
ATGGACTGTGTCTTCTGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGTAGACGCTGTTTCGCCTTC
TCAGCACACGAATGTCGATGTCGACGGCGGACCACCCGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGC
CCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTAAACGGGTTGCG
CCACCCTCAGGTGTCGTTCACATTACGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGG
AGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTNTGCGCTGGACGTAGCGCCAGAAGA
GGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAG
CGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCA
CGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGTGGGA
AGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGCTGTCGCCGGCGTCCTCCGCCTCCTTCCCTGACGAGGCCTTTGCGTCGGCCGA
GGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGAAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTAC
TGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACT
TGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTC
GTTCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCGGCGGTTTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNACTTGCTTCAGCTCGTCCATTTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTC
CAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCG
CTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCT
TCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACC
CCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGTGGGAAGTAGCCCTGCGGG
TACGTGGCATCCCCGCCTGAAGAAGACTCGATGCTGTCGCCGGCGTCCTCCGCCTCCTTCCCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGT
CGCCTGCCGCCAGCTCCGTGCCTTCGGAAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCA
GTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCG
GCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTTCTTGGCCTTGG
CCGCCCTGGTCTTCCGGCCCTACGGCCGGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCC
TGCGGCTTGTTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAA
TATGAGTCGCCGGCGTAACTTCGCTCTGATTGGTCGATAAGATCGAATCTCAAATGGGTCGTATACTGTAACGGGGTTACATGAAATAGTGACCCTGTCA
CTATTCCGGGGTGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTT
AGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACAC
GTGAAGGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACATATACAGA