Description :
From Genome Similarity Track
Location :
Scaffold_60:3- 5525
Sequence
5522 bases(100 bases per row)
AACCCTCGGTCCCATCGTCATAACCATCATAGGCCGGTTCCGGTCCCGCAACATCATCGAGCTCGTCGGCGAGGTTCCTCGAAAGGGACTTGGTCGCCCC
GCTCAGCCCCGATGATAGCGTGGCCGTCTCCGGCGTCGCTGCGCCTGGCTCTGGAGCCGGCGTCTTATCTTCGTAATCTTCATAATCGTGGGCGTCAGGA
CCGATGTCCGCTTCGTCGTCGAAGCTCACTGAAAGCTCGGTGGCGGCTGCAAAGCGCGCAGCCGGGCTTGAACTCTCGTTGCGAGCCCCGCCAGACTTGG
CAGGCGTAACTGGTACCGTCGGTTGTCCTTTCGCCATGTTTCTTGTCTTTTTCTTGTTCTTCTTCTCTTGGTAGCTCGTAAACTGGAAGGCCATACAAAC
AGTTCACAATGGTCACAATCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAGATGTAGTTAGGATGTTCCCA
CAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTT
ATATAGGCCAACCAGTAAAATAAGAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCA
CGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACGCTCGGCTGGAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACAA
TAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGTTCACCGAC
AGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAGCTTAC
CCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATATCAAGTGAACAATGATCCGTTATGGATCTTCTTGCATGCCAAGCGTCGTCTG
CACTGTCGCATGAGCATCTTTAACGGTCCGCGCCCTGTCCCAGACGGTTAACGTGTCTTCCAAAGGTCGCTGAGTATTCCGCGAACTCATCCCAACCGCC
ACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTGACATAGGGCCGTATCC
GATATTTGTTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACCTGACCGAGGGTTCGACGCTTGAACAACTTGGG
CGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACCACGGAGAAATCACTACACCACAGTATCCTGAGCCAAGGGGACCCCACTTGAACCAACGTCA
ACCAGTTCCACGTCACCCTGGTCATCGCTGAGGTCTACAACGGCGGGGTCGAGGATGACGCTGATTTGCGAGGTGGCGACCATGAACGAGGAGATGACGG
TACAGACTGGGACCGAGTCTTCGAATGATGCCGAGGCGACTTGCCCGGAGAGCGAAAACGAGTCTTCTGGCGTTTCTTCTGGCCGCTTGCTTCCAAGCCT
TCGGAATAAACAGCGAACGACGTGTAGACTTGGGAGTTGAAGGGGCGGCAGGTGGCGCATCACCGAGACCAGCAGCTGCCATAGACGTACTGGCCTTACC
GTCGGGATGGGGGCCTTGTCTTCGTCGGAATCGTCTGACTCCTTGCCACCTGGTCGAAGACGCTTGTGGAGTTTTCCATGAGCCACTTGATGAGCAGCCT
GCATTAGGGCTGCAGGAAGAGCTTGGGGATCATGCGAAGACGCGGCCGCAGACTTTATGTGTGGAAAGGCCACCACCATCTCCTGGTCCAAGTCCAGAGC
TTCCAGATCCAGTTCACCCGCAGTGAGACCTGCCACAAAGAATTGTGAATGAACGTTAGCTGCTGAACTCACGGTGGAAATAACAACATGAGGAACGTAC
CATCAACAGCCAGACGCAGGACCTCTGGATCCATCCCGGCTAGACTCACGTGTGTACGGAGAGTACGGCTTACTTGGAGGAGGTGGGTGTTGCGAGCTTG
CTGATTCTCGAGGACCTTGAGCGTGTCGTTGTCGATGTGTTTGCCCTTGGAAAGCTTGACCAAGAGGAGATGAAGTTGGCGAGTCTGCTCGGTGTTCGCG
TCAATCGAAGACTTGTACACTTCGCGTTCGCGAGCCAGCTTCTTGTTCAAGGTGGCGATAAACGCGTCCCGCGCCTGGACCTGGTAGTGCAGACGCTTCA
GGTCCTCTGAATGTTGCTCCATGGAAGACTGAACACTCGCGAGCATGGCATCATTCTTGGCGTTGGACTCGCGGAGAATCTTGACGTCCTTGCGAAGAGC
TTCGACTTCGGCGTTTGCAGCCTTCAGGTACGCCTCCGCGCTCTCCCAAGCCATGATTTCGGGTGCCACCGAGCGTACTGCGGCAGCAGCCTCGGTATGG
GCAGCACGCAAGTGACGATCCAGGCTAACAACTCGGTCGGGCAAGGCCGACAGCGCATCGGGAAGAGGCTGTACAGCGGCGAGGACCTCGTCAAAGCCCA
TTGCAGTCTCGAGGCGACGTTGAGTACGGACATCGCCGTGAATAGGAGGCGCAACGTTGAGCTGCACTTGATGATGAGCCATCGTAGTCAAGTACGGAAT
AATCGATGTCATCATGTGATCAACCGACGCTTCCGTACTCTCAGCCAGCATGGCGCGCAACGAATCTTCGGTGAGTGGTGGAGGACCACCTGCAGGCGCA
GGCGGATCAGCAGAAGCCATCCCCGTGGATACAGCGACGACAGGAAGTGCCGCAGGAGCTGCAGCAAGAAGTGAAGAGTTCGGGACAGGAAGCACCGGAG
GTCCAGCCGACGACGTTGCTGTCGAAGGAAGTGTAGCAGGCTAAGGGCTGTTCGAAACCTCGGTGTCGCCCTCCTGAGAAACGAGACGAGTAATGCATGG
TGATGAGCAAGGTACCGATGATTCAAGAAGAAGATGAGCTGACTTACCTCCAGCTGTTCACGTTCACGTCGTCGGCGAGGATTAAGAAGTTGGAACGCGT
TATTCACGGCCCGATTCAGACGCTTGGACATCCTGTGACTAGATGGTGAATTGGAGAATGAAGAAATGTCACAACGGGCACCAGTACCGTGGCTTCCATT
GCGACAGGGGCAGTTGTGGTGTAGTGATTTCTCCAGAGTTGCGGATAATCGCCCGTCGACAAAGATGCGGCACCGCCCAAGATGTTCAAGTGACGAACCC
TCGGTCACGTGATGTACGGTGACTCCAAGGTGCAAGCGACGCGACGGCGTCACTACCGAACTTTCAACGGATATTGGATACGGTCCAGATGTCACTCAAT
CCAGGCTGTCCTTATTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGCCAAGAACTGACTATCTACGGTGCAAACCCTCGGTGGCGGTTGGGATGA
GTTCGCGGAAGCCTCAGCGACCCTTGGAAGGAACGTCCACTGTCTGGGACAGGGTGCGAGCCGTTAAAGATGCTCATGCGACGGTGCAGACGACGCTTGA
CGTGCAAGAAGATCCATAACGGATCATTGTTCATTTGATATTTGTATACGTGATTAGGACCTCTTATTAGGAATAAACACGAAAGTACAAACATAAATAC
AGAACAGAATTTCCACTCAAGCACACAGAGCAACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGATCTCGA
AGCCCTGTAGCCATGGTTCATCCGGCAAGACCAAGAGACTGTGTGTTTTGGCCGATTACTATCGGGAAGGTTTTACGTGACGGCTTTTTGCTGCCTATTT
GCTCGACTGGGAGTGCTTGTTTTGCACCCCTTTTATTCTTCCAACCGAGTGTTGAACACTCGGTGCCCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTT
CCGCTGTTGGGACCACGAGGATTCATAACACCTATTAGCTTTTGCTTGTGCTAGTAGCGTGTTCTTATTTTTACTGGTTGGCCTATAGAAGTAGCTTACA
AGGTCCAGTCTGTCCCGGTGCAAAGGCAGAACTGAGGTCTTCAGGTCTGGCGGAACGATTATTTACTATCCTAGTAGACGTATTGTTATGGGAACGTCCT
AACTACATTTGTAGCTAGAGTTCACGTGGGAATTCCAACACCACACCGAGCACAACTTCAGGTCGGCTCGACCTGGTTGGACCTGGTTGGAGCGCTGGTA
GCTTATAGGCTTGTCAAAAGCACTTTGCTCAAGAAAATGTCCAAGTAGGCTGGTAAAAGGGTTATTTACATGTACTGCAGCGGGGCTGCCGTAGCTTTAG
CGTCAGAGGAAGACGTTCGACATAAAGAGTCACTAATATTAAGTTCCTTATCCAAAGGAACTTACAGCCCACGACCAGGGCTCAAAGTTAATACCTTAAC
TTTGATGCTTCGAAACCAGTAGTGTTTTCTTTACTACATGTATTATTGCGGCCCAGCCGCCTAGTGGTAATTGTATTTGTTTAACTATCAAGCACAGTTA
AACCTAATTAAATGCATAACGTGTGGCTTTTAGCCAACGTACTGAGAGACCTTGTTAGCTCTACAACTTATGTACTGAACATTTGGTAACTCTCCGGGTA
CTTCGTACCCCTGTGTTCCACTCCAGGAAACCCCGTTACCGTATTCCTTATGTGATTGGCGACGCTCGGTCATTAGCGACAAATCCAGCAGCCAATCAAA
TTGATTTACATTTCGTGTCGTCGCGCTGTATGTGCTTGGCGACCAATATACATGTAATTTTGAACATGTAAAATAGTTTTTCTATGCAGGTATCTTTTAC
GCTGGCAGAAACTGTACCACCTCAAGAATTTGACTGTCGCCAATCGGGAGTCGTTACTGCAACCTATCTACGATTACACGACAAAGCGCTGAGAGCAACC
TACGACTCTCTTGGGTTGCTGGGTAATTTATCATGGTTTATATTACGTAAAAAATCACAAGAGCCGAATTTTTAAATGTTGTGATAGCTATGTTCGAGTA
AGTACGAATTTCTTACTTTGTTCGAGTAAGTACGGATCCCACGGTCCCCCCGTTTTAAAGTAAAGAAAGCGGGAGTGGAGGCCGCAGCCCCGGCGAGGAT
GTTGGCAAAGGGAGCGCCAGCGCAAGGAGAAGACGGCTCTACAGATGGAGGTACGGGTTCAAGTCATCGTGGTACTCGTGCTGCTTCCGCCACCTGACGA
TATTTTGTTTGTTTATACAACGTCGTGCTGGTTTGCGATACCACAAGCCAGTCGACTACGTCCGCGCTGCTCAAGGGCTCACCACGGACCCTGTGGACGA
TGATATGTATATCGATGACCCG