Description :
From Genome Similarity Track
Location :
Scaffold_1633:3- 4117
Sequence
4114 bases(100 bases per row)
GGATACATCATTCAATTGAAGTCAGGGTGTTAAACCCAGCCGGGTACTCAAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCG
GAGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCG
CACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGT
CGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCA
GTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTG
ATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCGGTCGGA
TCCAGCCGGTCCTCTAACGAGTCTAAACCCGACAGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCTTG
GATCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATC
GTCCCCCGTCATGGATCCAACCTCCATTGCTTGGATCTCAACCCGTTGATCTCTCTGCAGGATCTTTCGCGGAGTTGGGTATGAAGCCCGATCCACCAAG
GAGCCAGTTGGCTCCGCCGGGAGCTCCACCTCCGCGAGGGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTATGTAGCGACAGGATC
CCACTAACACATATCCAGGTCGCCTAGGGATATCATTTTTCGCCAACCATCGCCCAACCTCCTCATAATGGCCCAGTAATAGTTTTTTGTCACTGACGCT
CGTATTGTGATCGACCTGGTCCTTGGATTACTGTAGGCACCCACTTCTCACCCCGAATGACCCACAGTTTCTTATGTTCCACCCACTTCAAGCGATCTGG
CAGCTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCGTCTTCGTCCCGTACAACGGTCGCCGTCCGCTGAGCAGGATC
CGCATCTCGTCGGGGAAACAAAGTGTCCTATCCGCCAGATCCAACCTCACTCCAGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGC
GATCTCCAACCCAAATATCGAACCAGTATACCAAACAACCTGCCAACGTGATCTTGATCAGCGTTCTCCCATTCGTACGGTACACGCCTTCACCGATCCC
AACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCCGGCACCACCATCTAGGAGTAG
GATTGCCTTTTTCATTGTTTGATCCTGCCCCCTAACATCGTGCTTGTTCTGAAACATTTTTCTGGGGCATGTTTACTTCTCAGTATCTCACGGACTCCCC
TGTCAGCAGATCTCATGGATTCAACCATTCTTCAGATTCCACGGGATTCAGTGACCTTGACACAACTTTGGGTGGATCTGCAGTGACCTCACCCTTGGTA
GGCTCAAACCATTGACCATATTGTCGTTTTACCCAATAACCCCGTGCCTCTCCACTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCAT
CCACTTGGCGCAAACGGGAAATCTTGGCAAATGACACTTCATGTAGATCACGTGTATTATCGACTGGAGCTAGGGTCCTGCTACCAGGATCGAGCGATGT
CTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCTGATTCAAACCCGGCGAGCGTCCTAGTTTAACATTACCTCGGCCACTTCTG
GCAACATCCCTCTGTGCTTGGCAGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACTTACCGACGTCGTGAAACTCACCACAACC
ACGACACACGTAGAAGCAATGATCTCCGGGATGATCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGAT
CCGCACTGCGAACACCTAACTTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGAATCCCTCGGTCGAGAGTCGTC
TCCGGTCTTCGCCGTTCGATCGTTGGACGTAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCAAACCGTCGGATCCTGATTCAGTTTCTGAG
TCGGTCGCCGTGACTTGGTGGGCACGTCGAGCTGGAGCCGTGGGCATCGGAGCTTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGTGGT
GTGTCGCGCGATCCACAGCCCGCAGCACTTCTTCAAGCTCATCTGCGTCAGGAAGACATAACAAGGTCAGTCTGTCGGCCAGATCCACATCTCCCAACGT
CTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGGACCCCCCATCCTTGATCTTCAGCTTGGTCCGTAGACCGGCCACATTTAGTCGATGCAGATA
TTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTTCCAATCCACAGTATTGGGTCTGGAAACCGCGCAACAAA
TCTGGCCACTTGTTCCTGGTGGATCTGCCCAGATGCCGATACCAATTCCTGGCTGGTTCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCGGCATCCG
ACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATAT
GGCTGGGATCCGTACCCTCTGGATCATGGAAGATCCACCCGCCCCGGCTGCGGCTGTTGCTACCACCGCTGACGAAGGGGATGGGCCATCCAGATCATCT
GGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTC
TCATACCCTGTTCGGCCAGAAACCGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGTGCCCGAGGAAGTGTCGGAAGAGCCTGCGGCCGTCTGGTCCACT
GGCGAGTCAGGATCTGTGCGGCGATTACCTTGAGCCCGATCTATGGATAACCCCACTGGCTTCTTGCCGGGATCTGGCTCGATCCTGGCTGGATTGTATC
AGATCACGGATAGGGCGTACTGGGATCCCGAGTCTTCACGTTCACAGGGACTTCCTGTCCCCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAG
GGTCCTAACGTCATGCGTCGGGGCTCGGACGACGTGTCTGACCCATCCTCAGCCGCGGATTCGTAGTCCGAGGACGCAGCTTGGCTGATCCTCGGCGACG
ACACTGGATCCATAGTGCGCGACCTTCCTCCGGTGATGGACTTAACTTTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAA
GATGTCCTCTGCGTCGAGCACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTTATAGATCTTTGACTGCCACCAACTTGCTCGCCGTTTTCGTTGGT
GCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATGCAGGAAGTCACGTAAAGCTTGGTGGCGATACA
CAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTT
CGTCTTCTTTCTCG