Description :
From Genome Similarity Track
Location :
Scaffold_670:3- 4105
Sequence
4102 bases(100 bases per row)
TAATTTACAGTAGCAGTTTGGACATCGGGGATGGATCAACCGATTCCATTCCGTACCCAACACGTTCACTGTCCTCGTCATCCATTGGTGACTTCAAGGG
AGTAGAATCATTTAGTTACATTATTCAGTTTTCATCCTCCGCATTATATGCGTGAGGTGAACCAACGTTACCTGTCGATGGCGAGACCGCTGTACTAGCA
GTAGGTGTCGTGACACTAGCATCTTATGTTGTCGTCGTTTCATCGCTACGCACACGCTTAGTGGTTGAAGATTTTTGAGCGTCTTTTCAGGCGAGTAACC
GTCCTTCCCGAGTTTAGGTGGCATTAGAACGCCGATCGGTGTCGCTCAAAGAAAGAGCGAGCTCACAGGCAGTTCATACAAGCAAGCACAGACGACGAGC
GGCACGTCTTTGACGGCTCACTCTCAAGTGCTTTTCCTTCGTTGAGATTTTCACAAAAATTGACCAATCGTTTTGAAGCAGGGGGTGTAACGGGGTCAAA
CCGTTGCACAAGACTTTCCGTGTAAAGGGACGGAAAATTCTGAAAAAGGTTCTAAGTCCGGTACGCACTTAGACCTTTCATGTGGTTGGGGTACAGCGAT
TGTGCACCTGTCACAAAGTGTGTGTCACACACGGATGACGTCAATACTTGACGTCATTACATGATGTCATTGAAGTACGTCATCAGCGCGCTTATATTCA
GTGTAGGCGTGCTGTAAAGACGTCGTCTCATCAGAGCGCGCGTCTAATCTTTTTCTTTCAGCCAATAACAATTTAGATTTCTGTTTAATTCATTAAACAG
AAATCAGTCTTTAATTGCGACCTAATTGTAACGTGTGTGTCAGAGGATGGGAGACTACGTCCGAGCCACACCGAACAACAAGCGTTCGTCCATCGGTGAG
ACAGTCGTAAGACGCCCACCTGAACCTCGCTGAACGTGAGAGAAGACGGTAAAAACCCTTCCTTGCAGGTATGCGTTCAGGATATGCGTAGCAGCTTGAA
GAGCCCGCCTACAACCTCGATGTCATGGAGTGTGATGACGACGCGTGCTTTGTCCTTGCGCATCTTTCCTAAGCACGCATCACGTTTTGCCTTGTGAGCG
TGGATATCACGTTGTCAGAGCTGGCAGTCATTGTATTCAGGCCTTGATACAGCTTTTACTATTTCAGCCAATAAAACACAATCGGTGAGTTAGATTGCTT
GTAGTAACCGCTGTGTTTGCTTGACTCATTGCATCATATTTGATCAAGCTTCCATCGGTGTCGTCAAGTCTCCGTCGTTCGGTCTCTGCAAAAAAGAGGC
AGGCTATGAACGAACCTTGTTTCAAGCTTTAGAAATGTCTCTGATTGGCTAACGAACAAGCTAGTGTGGTGGAGTGGCGATCGCTCATTTTATCAGGCGA
TCCCGACTCTCCACTGGTGCCCAGAGAACCGACTATCGGAAGGGATACTCCGTTTCCGTGCTTTGTATTTCCTTCCTCACCTTGTGCACTCGTCGGTAGG
GCGGGCTGCACTCTTCTCGGTGGGCTCGTGTCGAGATAAACTTGGTCGTGTTGGGAATAGAGTTTGTGATCGCGCGGAAACCTTCACACGATCACGGGTA
TACTTGTAGGTTACTTATTGTACGCCGCCTAGATCTCAACGAGATCGACTTGTCCACTTGAGCCGTCTCGCGATCTTGCGCCTTGTACTTTACGTTCTTG
CTGCGTCCAATCGCAGTTGGGGTTGTCTTGAGAATTCTTGATCCCCAGCCAATTATCTGGGGATATCACTTGATTTCAGTATGCGCGGCTTTCTTGAAGT
CGGGAGGCCAATATTCCAGCCTGGAAGAGAAGTCGACACGTGTAATTAAAAGCAAATAGAATTCTGTTTAATGTCAACCACCCAAAAGCTAAAAATACGA
ATATGCCTGTCTATATGCCAGGATATGCTGCCACGTGCCCTCTATATTCCGTTGATCGTTCCTTCGCATATGTGGTCGACTTACGCTGATAGATCATCGA
TCTCCTTGACCGATCGTCGATCACCTTGAACGATCTTCAATCACCTTGACCCATCGTCGATCTCCCCGATCGATCGTCGATCTCGCCGATCGTCGGTCTC
CTTGTTCGATCATCTTCTTATCAATCGTCAATCTCCTGATCGTCGATCCACTTGATCGTCGATCACTCTTTAGGACCGTGATCCCTGCCGATTTGTCATT
TATCTTCTCGACTTTGAACACCTTATTTGTTCCCGATCTTGGTATCTTGCCTCGATCTTGGCAACTTGACATTCGATCCCGTTGCTGTGATATTTGATAG
CGGTATTGCAATATTCGGTTTTGGTATTGCGCAACTTAACAGCCAATCGATCCTTCTCACTGAACTGTCGCGGTTTGAGATCACTTTACCCAAAACGATC
GCCCCCGATTGCTTCTAAATTCCAAGAGGAATTGATTGATCAAGAGGAACGTATACAGGAGATTCCAATCCTGAAGTCTTCTCTCCCGAAGTTTAAACCG
GCCCGCCATGCCGAACAAGAGAAGCATCGGCTTCAACTGGCTATACACCAAAATGAATTAGAATCAGCAATCGCGTCTTCTAAGGATGCCGATGATCAGG
CGAAACCCCAGATTGAAAACACGAAAGCCCGATTTGCCGTCCGCCAGTCCGCGATCATGCGGGAGTTAGCCATGGTCCAGCGAAACTTGGGTACAGTCAA
AGCTGAGAGCGATCGCTTCGCAGCTCAGATTTGAGATCTCACGACCCAGCGCGATCGGCTAAACTTGGATCTCGCCGATTGAGATGCCGATCGTAGTCGG
TTAGTTAAGAAATTGGGCGAGTTGAAGGTAGAGCGCTATAAGGCACTCCAGCCGAAAGATTCGCTCTTCACTCGCATGGCTGAAGTAGTCTCCAGTGCCT
CTCCAAGTGCTCTGCTTGCGCCTGCCGCGCCTCCCGGAAAAAATCCACGCGTCGACACAAGCGATCGCCCCCTAACTCCAAGTCCGGGAAACCGAAAACT
AAGCGTGTCCGTCGTACCGGATCGTCGCCGAGTCGATCGGCTTCTCCTGATTCGTTTGGCTCTCGATCTCCATCGCCAGAGCGATCGGAGGGCAGCGATC
AAGTTGATTTTTCTGCTGCTGATACCGATGATTCTCTGCTGGCGGCATTATCGTCGTCCCGTTCTGCCGCCCGACGTGAAACTACATCGCCTTCCAAGAA
ATCATCGCCTGCTCCTATTCTCCACTGATCAGCGTTGATCCCCCCAGTCCGGAACACCAACCTCACGGTAGTCCTTCTCGAACATCCATGGTGGATTTGT
TTGGAGAGCCGTCAAGCGACTCTAAACGTGACCTTAGCCTCTATGGTGATTCTCGGAGTCCCTGTAATTCACTGCTGACTCCTGAAGAATATTCGGCACT
TTCTGACACCCACATATCCCGCGATTTTTGGATTCCGGGGTATCGCAATCGGGTTCCGCGATCGGCAGTAGATGTGTCCCCTTGGTCCGCCCGAAGGAAT
GAGCCTGATCAGCGTATCGGAGCTAGACATAGATTTGTTCTATCATCACTTTTCAAAGCCCAATGGATACATCTTCCCGGTCCAACTGGGCAAACTTCGC
CCTCCTCCGGAGTCGTCCTGGTCATCCCAGCTTTGATCATGTCGACTAAGATTGAACAATTTTACGATCAACAACCTTGGAACCATTATGATCAAACCAT
ACACCCGATCTCGTTAAGCCTTCTGGCTGGTTCGAAAAACTGGTCGAGGCGTATGAAGTTATCGTGGATAGCCATCGCCAAGCTCTGTGGGAATCGACTC
ATTTCTTGTGGATCTCCGCTGAGCACCGTAAAACGGATCCTGGATTGGTCGCTATTGCGCGAGCGAGAAGGCAGAGAAGATCTCGTGCTGGTCCCTGTTG
GAAGCGGGTACTGCAGCTGATTCTTCAAGGCATGATCGACGGCCTCTGCGATTTGGACATTTTACTGGACTTCATCTTTCTACACTTTCCCCGTCAGAAT
GAGGCTAGGGCGTGGTATCCCGGCCTATCCGTGCGGCGGACCAACATACCCAACTAGATCACTGCTTTGTCGATCGATCACGCTACCGAGCGTTGGAGGA
AC