Description :
From Genome Similarity Track
Location :
Scaffold_214:3- 4046
Sequence
4043 bases(100 bases per row)
GTTGCAGCACTTCTGGTTGCCCCTCTTGTTCGGGTCGATCGAGCCGCCCGACGCGGCGCATGCCTTGATGGTGAAGTCGGCGGTCAAGAAGCCCGTGCTC
TCGTATCTGTTGTTGCTTGCTCCAGCACACTGTCGGAGCGCACCGTCACTGATGGTAGAGATCAGTAAAGACGGCATGTGAGCCCAGGTGTCGGTCGAGC
AGGGCATGCACTTACGTGGGCATCAGCAGAGCGGCGAGGGCAACAATGACGATCTGAAGCTTCATTTCGGGAGGGGCGTGTGGAGCTCGCGAGTTGAGTT
GAGGTGGATGAAGTAGTTTTCGAAATGAGCTGTTGTGGGGAGGGTCATCAGCCTCGCAATAGTAGGGACCGTAGTACATAGGAACGATAGCCCCCCTAGA
CACTCAGTGGCCGCCTTCTGCATCGACCGAGTCGAGAAGATCAACAGTTCTGTCCACGATGTCTGCTTTTGCTGTGCGGTCGTAAGCAATGCATGTGCAG
TACGAGTGCATACAGCAGGAACGTAAGAATGATAAATACATACCTCCTCCCCCTCCCGCCCTCTGGATTGAGTCAATACTGTTGTCACGAGATCTGAAGA
CCAACAATCCGGTTTACTATCGTGATGTTGTGAGCCACGCAATACACAGTGTCAGGATACGCCGTGGCTACGTGGCCATTGCGTGGCTCGCGACAAGGAA
TTATCTTATCGGAGTGGATGTCCACCCCGATGTTTCCTATAAAAACAAGTGCAAGCTGTACTAAGCGAGTGAAGCAGCCAACTGATGTTCAACTCGAACG
CGATGGACTTGTGCGTTGGCTCTCGTCTGCGCCTCGCATTTGATCGCGCAGACACGCCCGCTGGCTCCAGAAAATGTGTGTTGGGTACATCTGAGTGGGC
ATCTACTTGGATAGGATATTTCCTTGGATCACGACAGCACGGTTGAAGAAGATATAAACAGTATTGATGATCTACAGGTATCTACAGCCTGCAGATCTTC
AATCCTGTCTGCAGACGACAGAATCTGTCGTCTGTCACAGATGTGTCCGGTCGCCAGTGTAGTGTAGTGTAGTGTAGTGTGCGTACCAACTTTGACTCGT
CGGCAATCGGCTCTTCGAGAGGGCAACCTAAACAAGACGAGGACAATCAAAATGGCTAGAAAGTGAGCATCAGCAACCGCTTTTGTGATATGCACGTTCT
GCCGGGACTTCCTTCTTGGGCAGCAAGACGACGAACTACGGTACTTCAAGTACCGTACTTGTGTTCGTTTCATATTTTAATTTTTTTTTAATATGTTTAA
ATAGAGTGGTGTGTGCTTTTGTCCGCGACTGGACTCGCGCGAGTTAAAAATCAACCAGTTAAATTGAAATTACTCATGCGGGTAGTTTGTTACGAATCAA
TTGACTTGCGCGAGGTCATTTGGGTCATCTAATGTGATTTTCTTCTATTTATCGCACTAATTCATGTTCGTACTTGATCATACATCATAGAGGCCTTGAA
TGCGATTTTGGCTCGGAAACGACACTTTCTAAATATACCAAACGGGTGTTTTTTTTTCTTGCTGGGTCGCGCACGATTGACCATCCACGACTTTTCGCCA
TTCACAGTTTCTCAATAAGTCGTACGAGTTACACAGTCCAAAAGCTTGCATTGCACAATACCCGATCATTGCAGCACAGTACAATCGCATTATGTACATG
TGTACCATCGGATCGTAATCCCTGGTCGACCAAAGCCCGGATTTTGGTGCGATTGCATGAATCCACCCTTTGTGATAGAAACGCAACAGCTTTTCCTGTA
GCTGAAGGTATACGGAAGAAGAAAAAGTTGATTAACTAGATAGTGGACATGCGGTTTCGCTAGCTACGGTAAGTTATGGTAATATCTACTTGGACAACTC
AATTATTGCCGCGGAATCCAAATTCGACAACCCTGTTGGGGTAAACTAATTGGTTTGGGTGCATCAAACCCAAGTCGTTGGAGCACCGAGTTTATTGCAT
CACCGTCCGCTTCAGCTCTTCATAATGCTGGAACATGTATTGACAATGTCGGCGAAATGAGCTCACCAAACCTTGAGTGCTTGGTTGCTCTGTTGCTGCT
TCCTCAAATGGATATCGTTGCGAAGACGCCATGTAGCATGGAACACAATTGCTGTGTGAACTCTCCATAGCAGCAAAATGGTTTTATGTTGTTGCTTCCA
ATATGATTTGATGTCCCGTGGCTGCGGAAAAAGCAGTAACCTCCAGCTTAACGCGGCGTGGAACGCCTTGCTCCATCGCGCCCACAGTGATTGCCACATA
TCGTTCAAGCCGAGGCATGATAAGAAACAGTGCTCAAGTGTTTCAATCGCCACACACGATTCTCGAACGCACTGTTGAACCGTAGGATTGAGTGCCTTGA
GGAAATACAACCTTGAACCGACAATGAGATCTCCAAACATAGTCTTAACATGACATCATGCACCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAAAGCCGTTGGCCAGTGATGGGAGGTGTCTAAGAAGTC
AGCTAGACACCATCGCTGCTGAGCTGCAAGCTCTCGACACAGACATCTGAAATGAATCGTTCCTGTACCCAGAGGCTTTCGAGCCGAGTCCTCGCGACGA
TACACTTGGGATGAAGAAGATGTATTCCACCAGATAGGAGTGAATAGTGCATACTGAACGGTTCTTGCTCTCGTATACCGCAGCGTGTGCCGAAGTGGCC
AATGTACCCGCTTCCAGTCCTTCAACAACTGGCGCCACCACATTGGCAGCATTGCTATTCGCCATCCCGGTGGTTTTGGAGGATTCTGAAGCAAAAAGTC
TCCAGACCACCTTCGCGAAAATACTGCATATCGTAAGTGCAATAATTCAGCCATTGGCCTGTACCAAACGGCCGCACCATCATTTCCATGCGTATTCAGC
ACCTGAATGAACTGCTATCAATCAACAGTGGCACTGTTGCCGATCGTCAACAGAGCTCACTTGGTTTTTGTAGGGGGGAGGGGGTGAATCGGTCATCCCA
GGGGGAGCCAAAACTAAGCCTCCGATTCAACAATTGTGTGCATGGTGCGTGGGTTTGAGCCGAAGCCTGAGCTTCACCTGGCTTCGCTCGTCCCGAGGAG
GTGTCGGTGTCCTCAGGGCTTTCGCAGTTCTTGCCTGGGTGTGGTGGTGCAGTCGACACCTCAAGCGTTTGGGGATTTGACGCCCATGATACCCGTCCCG
GAAACAACCTGTGCAAAATAGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN