Description :
From Genome Similarity Track
Location :
Scaffold_1571:3- 4010
Sequence
4007 bases(100 bases per row)
CAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCAGGACGGGGAACGATCCCAGAGTCGGCCCTTAAATAACGCAGGGTCGGTGGATAAA
GGATTGCAGAGGGCTTAAGCCGAACAGCCGGATCCCGCTGATCCACGAGTGGATCCAAGCTTTACATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGG
CAACACTAGTCAAACCAGAACTGATATCAGGGTACCTGATTCCCCGAAGACAGAAAGACTGCCAGGCGAAAGAAGGCCGCGGTGCTCGGATCCAATGATG
GATCCTACGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCGGGGATCTACACGCCGAGGACCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTAC
CACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAG
CCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGTGACGCGAAACCGATCGCTCAGAGG
GTGAGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCAT
CCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACTTCTGTGTATAGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGAT
GCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGA
GCTCGCGCGATATTTGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAA
TCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCC
AGGGGATCCTGGAACCCCGTCCGTGCTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACA
TCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCA
AGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGATTTGCCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAA
CTACTACAGTCAGTTCATCGAGGATTACCCCCTGTTTGCCGCGGTATTATATGAATTGAGAGAGGTAGATTTCGCTGCGATGACCACTCCAGCTGTCCGG
ATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCAC
CCCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACAAATCAGAACATGGAAAAGGCAGAATCTAGGTGGATCCGAGCTCAACACGCATTCGT
GGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTAATAGTTTATGCCAGCGACTGGGCAGTCTCA
GCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAG
AGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTT
CAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACGCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCC
TGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGAATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCC
GATCCCAACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGG
AGACTACCTGGATGGGAAGTTGTACGGGCTAGATCCGCTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGATACTGCTGGTTTTGGATC
TACTAAAGGGACAACATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAAATTGACTGCAAAGCCCCGGCCCT
AGCACTGTTACGGCAGAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGCTTGG
CCAGCGCCGCTTTACGGAATCAATGTGGTGTGGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGTTAGT
GGGATCCAGGAAAAGGACAGTCCAAATGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAATCATTTGTGAAGAGA
GTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAG
ATGCCAAATCCTACAGAATTATCGCTACGGATTACGCGGTGGATCTAAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGA
TGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACC
TACCAACGGATCCGGGAATGTTTCCACTGGAGGAGACTATTAAAGAGCGTACAACGATATGTTGGTGAATGTGTGGATTGTGAGACAAGCAAGGGCAGGG
CACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTGCCCAAGTCGTTCAAAGGA
AACACAGAATTGTTGATCTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGG
AGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATGTCTTTCGAGCATTCAACCGGATCCTGGG
GCAGCGACAGCAAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACAAGAGCACTCAAGATGTACGTCTAG
GATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGTCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGG
TACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCA
GAAATATTACCGGCAAGCTAGATCCCAGGTGAACGAGTGACTGCGGAGTGCGATACAGGATCGGGCAGATCGACACAACGAAGACGCCCGTCCACATCAA
ATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGAATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATTTATGGCATGGACCGTTCCGGGTGAGCG
AGAAGAT