Description :
From Genome Similarity Track
Location :
Scaffold_980:3- 3989
Transcript NameFunction/comments
g16859.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g16860.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
3986 bases(100 bases per row)
ACCACACGATCTCCGACCTTTCGCTGATGCCGAGTTGCATCAGTGCGCATGCCGAATCGGCGCGAAATCGATGCATCGCACAACAAACGTGGAAATGGGC
GATCTTTGGTCGGCCACCGCGCAGATCGGCCGACTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGCCCATTCCCATGCAGCC
TCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGTCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCT
TTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTAACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTC
GGTTGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAAATGCTCTGTATGCATCTCCACATCC
GACCTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGA
ACGTCGCTGGGGCGTTCTTCAGTCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGCGAGAGGAATATCACTCTCACG
CATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGTGGTATCGGCGTC
TGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGAGCGCTGTGCGGGG
ACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAATCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGTGTGACGCA
GTACTTCGTTCCCGGCACGAGATCAATCTCGTGCAGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATTCTTGTACTCACGC
AAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTAAGGGCGTCCGCGCCCTCAGAGA
TGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACG
CTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTCTCCAGCCTAATTTTCTTGTATTGGAGACCAATGCTCGTACGCGTC
AAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGTGTCTCGGTCCCTGACCGAGACTTGCGTAGCTTTT
CTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGG
TTTTACCAGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGTCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGA
CGGTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGATGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTG
TGTCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGAATTGAACCAGGCCCTGCTGATTCGTTTCACATCTTCT
TCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGTGGAGGGCCGCATGCACCACGTGGTGCAT
GTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGC
AAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATATGAGAAGCGTACTCGT
ACGATACGCTTCTCGGTTCTAACAACGACACCCGTTTCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGTCTTGGAAGGC
TCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTT
GTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGG
CGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGGCGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTC
GCGGGCGTAGTGACCGATGTTTCCACAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATT
GGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCGGTTTAGCATGCCGCAGGCTAAACTCTTCTTGCATTG
CGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAA
TCGGGTTGGTCACGATGTTCGAGACCAAGGACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGA
TCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTCTGAGCTCCTCCTTGAACTCTTCGTACGTGATGAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTAC
GCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGA
CAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAGATGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTCGCCATCGGCCACACCGAAGT
TCGAGCAGCGGTTTTACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATTGCGTTCGCAACATCGTTGCTACCGCCGCT
TCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGC
TACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTTGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTA
CCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTGATTTACTTAAGTTCAGTATACTT
GTATCCGCAAGTATACTTAAACTAAGACAAAGGGACCGAACAATAGCTTTGGTGCTGAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAAC
TGATATTTCTAATGAGAGGTTCTGCCATTGGATGGATGGCAGAGCCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCAT
ATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCCGAATGTATTCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG