Description :
From Genome Similarity Track
Location :
Scaffold_1070:3- 3862
Sequence
3859 bases(100 bases per row)
TCTCTGCTAGATGTCGTCTATCTACATGCAGACATGATTTATCTTGGTTTCAGTATAGGTTCAGTGGCGTAATCAGACAGGAGAATCTTGGCCGGTCATT
AACATCTTGGCTGGAGTATACTTGGGAATCTGGAAGATTCTTGATGGGAGCAGGATACTGGGTACATGGACTGCGTCTCGAATCTTTACAGCCCGGAATC
TCCTTTTGGAAGGAGGGACCTGCGGGGGACTTCCTTCATGATagcgtgcagcttcagcacggTCCACACTTGGTTCCTTGGAGAAGGTTCACCGTCAGAG
ACATCAAGCACTGGCTCGCAATCTTGCTGGTCACTGGAGGAGGGTTTGGACAGCGTAGTGTTCCGAAAGCCATCCGGATTTTGGACCCTTTCGAGGACGA
ACTTGTCAGTTAGCCGCGGCTACATGCCACGTGTCTCAAGGATGTGTGTActttttgaccaatcaggTGGTGGAGTGTCTGAAAGATATTGGGAAACGGC
ACTGGACAATTTGTGTGGAGTCGCCTCGCGTCAGTATTGCTCTGCAAAATGCTGATCGTATAGATAACTACTTACAACGTCTGCAAAAGGAAACACTTGC
TCATCGTTGTCACCCATAAAACTGATTTTTGGAATAAACTCGCGTGGCTCCCTGCGTATTACAGCTACATGGATGCGTGCATGACATACGGCTGGAGCTC
AACAATCCGCAAATACGCACCATTGTAGAGTCCAAGATCCGTGTTTGAGTTCCCTATCATGACAGAAATGCCCTCCATGAGTATTTAATGTCTGAGGTGG
AATCTCATTGCTGTTCACCGAGTGAAGCACCCTTTGCTTAAGGACGCTACCGTACTTGTCGTCATACTCGTATCAGGGTTTTTCCCCGTCGCCGTACACA
AAATCTATTAGTCGTGTCATGTATTTCAGCTTATATACTGTCTGCTGAGTGTGGGGTTAACATCTTCGTACTTGCCCTGGCCTGCTAAAAAATAACACAT
TTATCACAGAGTTAACATGAATTGTAGCCCGAAGCGGTTTTAGTTTACAAAACTGTGCAAACGGTAGGTCAAGGTTGGGATGCCGAGTAAGTACTGAATT
CGATAGTGCAATATCCCTTCGCACATTATTTAAAAGGGCTTGGCCGTTTCGGTCTATAACGCTTTGACGGGCCTGTAACGCTTAACAGCCGATTCTCCTT
CGGTTTTGTGGTTAGCGGACCGCGTACTACCATGTGTTTCCTGGCGCTTAAGTGGCCGCATGACCCTCAGTCGGAATAAACCCACAGGAAACCGTCAGGG
ATAAACCTATAGGGACACGGTAAGAAGAAACCCATATCCGACTAAACATTCCCTTATACAGCCCAGAAGCCTCTGGTTATCTAAACCTATCTGTACATAG
TACTACTGCGTCTCACCAACATGTATACACGCGTGTCTAGTGCCACCAGTGGGTCTTTATAAACTTGAGAAATGTGGTACGAAATCACATGCGTATCATG
CACATCCTAAAAAGTACCTATCAAGTAGACAACATAAATCTTAATGTAGTCCACAATAATGTCATGTAGTCTacatatatatatatatattagCCAATGG
AACACCTTTATTTTTAACCAATCTAATCAtgtttcttcttgtggcgcttgctgcgctcgcagcCTGAGCGAGGAGGTAGAGCCActggtggcagtggcag
gCCCATCGCAGCGGCCACCATGACCGCGTGTAGCTGTCGCTGGTCTGAAAGAGGCTGAGGCGGTGCGGTGGCACAGGGCGGTTCCAGCAAACGAGGAGGT
TCGGCCCGCTAGCGGAAGCAATGCAGCGTCGCGGAGAGGCTCTGGTCGTGCCCTCTGATAAGGCTTCCCAAGCAAGTTAAAGGATTCCATTGCGATTGTG
TATGGACAAGTAGCAGCTCTAAGAATATTCGGCATGTTTCAGTCAATTATTTTTAACCTCCAAAATTTCTTCCAATTACAACTTAATCCTATACAGCTTC
CTTACTACGCTCGGCGACAAAAGgtttttggccaatcacagcTGTCatcgctgcgctcggcagctaAAGGTTGTTgtggccaatcaaaatgcgTTATAAT
GGTAAGGTTTTTCAtgacggacggacggacgaTCAAGTTTTAAATTGGCCCCTTGCAGGCCAAAGATAGAATACAGCGGATTGAGACGAAAGATCCCAAA
GGGAGGCATAAAGCAAAACACAATCGCAGGAAACTCAAGGGTGACAATTAAAGCCAGCGCCAGGGCTTTTGCCTCAGAACGATAAAAGAGCCGGAAATCA
TGCGTCCTAAATGCTGTAGTGTTCTAATTGTCCTAAATGATTTGTCTAAATTACCGACATCTGTCCTAAACTCGTATACAGTAATATTATTAATCAGAAT
GAATAAAATACGTCGTAATGTGTGTCCAAAAGCATCCCTGGAGAATATTAACATGAGCATTAGATAGCAACGTTGTAAGCCGGACACATTTTGTACATTC
ATGCAGTTCAAGCAGTGGCTAGTTGCGCTTTGCTCGGCTGAGCGCCCTTCATCACCCGCCactcgcttcgctcgggatATGAAGATAGCACGGTCTGTTG
AAGTACAAGTCGGCGCCAAGCCCGTGGAGCTCTATTGCACCGATGTCGTAATTGCATATTCGGTAATCATTGGATTGTACTCCCTGAGAACTTTTTTTCC
ACAATAGGACCGAGGCTAGTATCAAGTAGAATACAGTGCCTGGATGAAGAGTGCCCTATTCGGACAGGGATGCTTTCGCCCACTTTGTCCTAATATAACT
AGTGCATTGACGAAATCTGCCCCATTCACCTGATATTTACCGTGCGTTTGTAGGACACAAGGCCAGTTTAGGACACGTAGTAGGACGCATTAGTTTTACT
CGAAGTACATAAGCCATCGTAGTTTCAAAACTGGATGTAAAATGTCGTGTTGGCTTTTGTTTTAACTAGCTATATGGATAGTCGGCTTCACGAGCTCTTC
ACAAGCCCCACCAACTTACACTACCGGTAACCATCctgcatacatgtataacTTATTATCGGTAGTAACAGATTGCCGCTGATTCGTAGTATCTACTCGT
TTGTATGGGTTCTAGGAAACGTTGATCTTGATTTTACTATCATTCAAAATGATGCGTGGTCGAATTACTTATACTTCTATGTGCCTGATTGGTGATCGTA
TAGTGTTCGCATCGTCGCCTGGATATCCAACAATCTGTTTCTACACATCATGCGTCAACCAGACGGGATCCAAGATATGAGAAGCATCAAAACCACCACG
CGCTCGAAGCGCACTCAGTGGTCGGCAAACGTCAAGCCGGCCCCAGAGGAGCTAGAAGGCGGCTATTCGCAATAGGAATAAGACTAAAATAGCCACAGCT
ACTGCAGTAGAGAAGATCACAAGCTCGGCAAAGGCCAGCCTATCTATGGCCAAGATGACAGCGAACGTCTTGGCTGCGAGCAGCATTGTGGTGAAGTTCT
TTTCGGAAATTACATGGATGAGACGGATAAGAAACAAAATGGTACTGATCCGGAGCAATGGCGGGATGGACAAGAACTGACTTTCTTAGGCATCTTACCA
ATTTAGATCGCACGTATATGAACCGGTAGTGGACCTCGAAGGCTCATATTCAGAACGTTCAAGTGAAGATAGTCCAAACCGGGCTAGATCGGCACAACCA
ACCATGGCAGATCTAGCATAAGACGGATTTATCTGAGTGGTCTGGACCGTCCTATGCCTAGACCACGCAATTGGAGCCGGGATCACCCAGTCTAGTACTG
GATCCTATCTCCAAACTAAGTCGTCAAGCGACCGGTGATGTGGAGTGATGTGGCGTAAA