Description :
From Genome Similarity Track
Location :
Scaffold_1743:3- 3480
Transcript NameFunction/comments
Phypl_g14059hypothetical protein

Sequence
3477 bases(100 bases per row)
ATGTCAGAACGAGCAAAGTTGATTTCTGCGTTCGTATGTCCGTTCGGACATTCCCAGTGGGTTCGCATGCCGTTTGGACTCAAGAACGCACCACTCGTCT
ACCAGGCTGTTATCAACAACTGCCTATGGGGTTTTGTGAGGCTTCCAcccgaggaggaagcggaggcggacTAAAATGTTCTAGATTTCTTAGGTCTGGA
CCCGTTCGAAAGCGAGAAGTCTGAACGCGAGATTGCTGCTCAGAAAGTTCAACCTCTGACCGACCTTATGACTGCCTTCAAACGAAACATCTCTGCTCCG
TCTCGGTCTTGGGACGTAGTTCCTATATCGATGGCATCGCTCATGGAGCCGAGACCTGGGACCAACTATGTGATGACctgaacgcgctgctgttccgaTT
CAGATATTGGAACATCTCTGTGAGGCTTCCGAAGAGTGAATTCGGAAAGCGCTCGATCTCCTACCTCTCCCATGAGATTAGTGCTGAGGGGATCCGAGCG
CTTCCGAAGATTGCGAAAGGAGTTCGAGATCTGCCGTTCCCGAAGATTCGAAAAGGTGTCCAGTCTTTCCTCGGAAGTCTGAACTACTGTCATAAGTTCA
TTGAAGGTTTTTCGGTGGTGGCTGCGATACTATATGATCTCTCGGACGAACAGGTGCGCGTGGGACGTGATCTGACTAAGGTCAAGGTAGCATTTGAGAT
ACTCAAGAGAAAGGTCGTTTCGACGCCGCTGTTACGTCATCCGGACCGGATGAAGCCGTTCATCATTATTCCACATGCGAAACAGTGGGCCGCTTGTGCA
GTCCTAGATCAGGAATACGACGGAGTCATCCAACCAGTGAGGTATACAGGTCGCGTTCTGAATGACGCCGAGTTGAGATATCATATCGCTGAAAAGGAAG
TCATCGCGATTATGCGAGTGTTGCAAGTCTTTCAGACAATTCTCGACCGCTGTCCTCTGATCATCTATACGAAATATTCCGCTCTGAAATGGGTAATCAA
GTCGAAGTCTGCGGATGGCCGATGTGTTCCGTGGGGAGTTACTCTGTCTCACTGGGATATGGGGATTCGCAAAGTCCAGCGTGATGAGGACGGATTGGCA
GCCATCATGGGCGCGGGTATTACCCCACGCGAACACCTAGATGAGATTGCTGAATCATTGATCCCCGCGAAGGGACAAGTCCGAAAACCACCAGTGATGA
TCGTGGAGATGTTGGAGGCTGACTATGAAGGTGTCGTTCTGAGTTTCGATGGAGACGCCAAGACGTCGACCCGACTTGGAAGTTGTGGATGTGTCTCGTG
GACTCTACCTGGATGGACGGTTCTGGAAGCAAAGGGTTTCATTCTGAATGATGTCATGGTGAACGANCCCGACTTGGAAGTTGTGGATGTGTCTTGTCGA
CTCTACCTGGATGGACGGTTCTAGAAGCAAAGGGTTTCATTCTAAATGATGTCACGGTGAACGACGCCGAGTATTTCGGCTTTCTAAAAGGACTGTTGAT
GGCGGTTGAGCGGGAAATCAGGGATTTGGTAGTCGTCGGTGATTCTCGGATCGTCATACAGCAGGTGCAGGGACTGATTAACTGTAATCAACCTCACTTG
CAGAGACATTTAGCAAATGCGGAGGTTTTGAAAGCAGAGTTCACGTCTCTCCGGCTGGTGCACTTGNATGGGACGTCCTAGAAGAGGATGAGCTTGTTCA
CCTGAAATGGTGTCCAAAACCCcgagaagctgatgaagtcCGAGGTTCCAGGTGCAGTCGTGAGTCCGAATGATGAACCGAAAAGAGATGCTCTTCCGGA
CACAGGATCTGCGCTGTTATCTCATGCCGCTAAGGTCATGGCCGTCATTACTCGGTCGGGAACTCAGCACGAGCCCCGTCCAGATGACCAACCGATGAAT
CCGTTGGGGTTTCAGGCGGAACGTTGGCGGCGCATTAAGGTGCAtcaggatgaagacgattGTCTGTCGGAAACCAAGACTTTTCTGAAAGGGGACGTCG
ATTGATTCTCCCCTCGCCGCCCCCGGAAGATTGCCAGGATTTCTGACTTGTTCGCGTTGGACGCTCGAGACATCCTGTACCGATTGGCGCGCTCGACCCA
AGATCGCCCGCGAGACGTTGTGGATGAACCGAGGCTCGTCGTTCCGGAATCACTCCGATCTGACATATTGCATTACCCTCACGAAGACTACCAAGGCGGA
CACCAGGGCATCACTCGGACGCATGAGAAATTGCGTTTAGAGTTTTATTGGCCTGAGATGTATGCCGATGTGGACCGATTCGGGAAATAATGTGTGGATT
GCGAGTGGTGTGGGACGATCTCCGAACCCTGGTACGTCGCCCGGAAATATCGAACCGAGAAGACCTTTCGAACTAGTGTCAATGGACTTTGTAACTCACA
TGCCGAAGTCGGACCGTGGGAATACCTTCTTGCTTCTGTTTTAGGACTCTTCTCCGGATTCGTCATGTGCAAGCCGATGAGTTCGACGACCGCTCAGGAC
GTGGCAGAGGCATATGAAGAATGTGTCTTTCAGAAATTCGGGGCGAGGTCGCTGCTTCAACACGACCAAGATCCCCGATTTATGAGCGAGGTATTCACTC
GCTTTCGGGAGCTCTTGGGGAGTCGGCAGCGTGCTACGCTAGCGTACCGTCCGCAAGCCAATGGTCAACAAGAGCGATCGGTCCAAACTGTCGTTCGAAG
TATCCGAGCATACATTTCGGAAGCCGACCAAAGCGACTGGGACGACCATGCTGAAAGGCTCATGTTCGCCCTGAACACCTCGTTTGACGCTACTCGCTTG
GACACGCCTTTCTACCTGGTTCACGGATGGGACGCTCAGGGGACGCTTTTAGCGATGTTGGGACCGAAACCTTCGAGCATAGCCGAGCGGGCTGCCTATG
AGTGAAGACGAAAGCTTCAGCAAGACTACAGCTATGCGCAAACATGCGCAGAAgacttgcagaagaagcgaAACGTCATCGTTCGGAAGCCCAAAAGGCG
AAGTGGCGTGAATTGTCAGAACGACTGAAAGCAGGATTCGAAACGGGAGATTATGTGTGGCTGTACATTCCCAAAGTGCAGACCGGACTGAGTAGGATGC
TTGCTCACCTGTGGCATGGTCCTTTCTGGATTGAGGATATTCATGATGACTTTCGGGTCAAGCTCAAAGTGGCAGACACCGGCTATCGTGTTAATCCATG
GGTGCACATAAGTCGTCTGAAACCGCGAGCCCTCTTTCTGAGACGACCTGCCATGGATATTGACATGAGCGATGAAGACAATTTCGATGCAGCTTTGCTT
CCTGAAGACAGTTGGGAGCCTGACTCGGAACGAGGATATTACGAAGGGGAAAAGATTGTGGATCTCCGATGATCGAAACGCACCCAAGTCGGGAATATCT
GGTCAAGTGGAACGGTTATGATGCCCCCGAATGGCTTCCTGTGTTACAACTGAGTTGTGGTGCTTTGCTTTATGAGT