Description :
From Genome Similarity Track
Location :
Scaffold_548:3- 3323
Transcript NameFunction/comments
g17301.t1hypothetical protein

Sequence
3320 bases(100 bases per row)
CGCTGCTCCTCATTTAGGTGGTCCTCCTTGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAA
CAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAG
TGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGA
CCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAA
CCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCT
CGGTCCTCGGCGATGGCATAGTAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTA
CGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCG
CACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTC
AACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTG
AGGAAGCGCAGAATCTCGTTCGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCAGACCCTTTGTAGACGA
TATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATATGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAG
TGGCGTTGTCGTACTCCCTGCCTTTCCATATCAGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCTGCAAAAGGTTT
CGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTGCTGCTCCACAGGGTCCATGCAGCATGCATGTCATGATCGTCTCGAAT
AGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACCATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGA
TGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTG
CAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTTCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTTTTCCCATGTAGGGCTG
CAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGCCCATATGAG
ATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCACGGCCCCGATCAGGGTGGACCAACGTATTATCGCCTCTGTCAAA
CTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTTCCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCTGTATTGATCGGCGCGAATTTGCTTCTGA
TGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGAT
CTCCCACTCTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGATGTCTGACTCCGTTCGCGTATGTGTCTGTGTAGGT
CCAACCTAGCTCCCCATACGGAAGCAGAAGAGGGTACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATAC
AGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATAT
TTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTG
CTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATA
TAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGT
ACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGC
TTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCT
TCCAGACAACAGCTCATTTTGGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGT
CTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTC
CAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTACCCTTCGCGCTTCGGCGCGTTCCTCCTGCGTAAGCTGTGATCTG
CGCTCCGCGTGTTGCTCTTGGTTTGCCATCCGTTCTTCAGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCTTGGTTTACCATGC
GATCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTGGGCATGTTGCTCCTGGTTTACTATCCGTTCCTCGGCACGCTCCTCCTGTGTGAGCTG
TGATCGGCGCCGGGCATGTT