Description :
From Genome Similarity Track
Location :
Scaffold_1439:3- 3258
Transcript NameFunction/comments
Phyag_g10629hypothetical protein

Sequence
3255 bases(100 bases per row)
CCATGTATAAGGACCAGATCACCTGTCTGCTTGGCCACAACGGTGCCGGTAAAACCACGTTGATCTCGATGCTCACCGGTATGACAGCGCCGTCCAGTGG
TAACGCTACTTACCGCGgtctgtcggtgaacgaagacatggacgagctgcgtcAGTCGCTTGGTATCTGTTTCCAGCACGATGCTTTGTTCCCGGAGTTA
TCTGTCCAGGAGCACCTCCAGTTCTTCGGACAGATCAAGGGGTACGCgaacgaagagctgcaagctgtGGTCGACAGACAGATTCGCGAGGTTGGCTTGA
CTGAGAAGCGTAACTCAAGGCCGAACGATTTGTCGGGAGGTATGAAGCGCAAATTGTCAGTGGCTGTGTCGTTGCTTGGAGATAGCTCCTTGGTGTTCCT
AGATGAACCGACCTCCGGCATGGACCCGTACAGTCGTCGCAGCACGTGGGAAATCCTGCTGAACAACCGCAATGACCGAGTGATGGTGCTGACGACGCAT
TTCATGGATGAAGCTGACATTCTCGGTGATCGCATTGCTATCATGGCTGAAGGCGAACTTCGTTGCTGCGGTTCGTCACTGTTTCTGAAGAACCGCTTTG
GGGCAGGTTACAACTTGACCCTCGTCAAGGACGATGCCAAGTGCGACGACAAATCTGTATCTGACTTCGTCACGTCATTTGTGCCGTCTGCGCAACTCCT
GAGCAATGTTGGAAGTGAGATCGCATTCCAGTTGCCTCTgcacagctcgtcgaagttcGCAACCATGTTCGCTGAAATGGACCGTCAGCTGCCGACCTTG
GGACTCTTGTCGTACGGTGTGTCGGTGACAACGCTCGAGGAGGTGTTCATCAAGGTGGCGGAGCTGGGCGACGAGAACAACCAGCACACGCTCGGCAACA
ATGTGCGAGCAAATAACTCTGAATCAAGTGACTACCAGCCATGTGATGAGATCATCACGACGGAGTCGATGTTCCAGAGACACCTGCGGGCCCTGCTCCT
CAAACGCTTCCGTTATGCNGCTACTTGGTATACGGCGACAGCGCGCAGAACTTGCTCGGCTACAACGTGTTCACGAACACAACGGCGTCGCACTCATCAG
CGATTTTCAAGGCCTTGATGGATCAGGCAGTTTACCGCTTCTTTGCCACAAACAGCTCGAGTGACTCAGCAACTTCGAACGTCAACCTGAAGGTGAACAA
CTATCCACTGCCGTATACGGCTGCAGCGAAGTCTGTTTTTTCGTCGAACACCTCGTTCGTGGCAGCTTTATTCGTCTGTATCGCGTTCACGTTCCTGCCG
GCGTCCATTGTGGTGTTCCTGgtcaaggagaagcaggcggagCACAACTcgaagcaccagcaattgGTTTCCGGTGTATCACTGCCGGCATTTTGGCTGT
CCAACTACATCTGGGATTTAGTCATGTACATCTTCCCGTGTGTTTCCGCGTTGATCCTGATCAATGTGTTCAAGATTTCGGCACTGACGGGTCAGGACTG
TACAAGCTGCTCGTCTGCCACGTTCCCGGCCGTGATTCTGCTGTTCGTCCTCTTTGGGCTCGCAATCTGCCCGTTCACGTACTGCCTGTCGTTCCTGTTC
AAGGAGCACGCGTCGGCGCAAACTTTTACGATCGTGCTCAACTTTATGATCGGCGTGGTGCTGATGCTCACGTCCTTCATTCTCGACATGTTTAGCTCGA
CTTCTGACGTCAACTCCGTTCTCAAGTTTTTGTGGCGATTCTCCCCGCTGTTTAATCTCGGCAATGGACTCCTCAGCATGGTCTCgaacgacgtcgacag
cgtccAATACAGCGAAGACGGCACTACCAGTCCATTCAGCGGGGACGTCATGGGATTCGAGCTGCTATACCTCGCACTCACAGCTATCGGCTTTATGGGC
CTAACTGTGTACCTCGACTACGCGAAAACATTTGCGAAAACCAAGGACGATGCCCATGATCAAGAAAACTTCGACGAAAACCACGAAATTGACGAGGACG
TTGAACGGGAAGCGCAGCGAGTAGCCAGCGGTGACGCTGATGACGAAGCTGTCAAGCTCGTTGGACTTCGCAAGGTTTACCCGGGAGGTAAGGTGGCAGT
CCGCAACCTCTCATTCGGTTTGAAGCGTGGCGAATGCTTTGGATTTCTTGGAATCAACGGCGCCGGCaagaccaccaccatgaaAATGCTCACGGGAGAC
GTCCAACCGAGCCATGGTACCGCAACTCTGGGCGGCTTCGACATCCTATCGCAGCAAATTGAAGTGCGTCGCCAGATCGGATACTGCCCGCAGTTCGACG
CCTTGTTCGACCTACTCAGCGTGCGCGAGCACCTGGAGCTGTTCGGCGCCATCAAGGGAATCCCACAAGCATCGCTCGACCGTGTCGTCACGGAGAAAAT
TCATCAACTAAACCTCGGCGACTTCGAGCACAAACTGGCTGGCAGTCTGAGTGGAggcaacaagcgcaagctgtcggtggccatcgccatgatCGGTAAC
CCGGCCATCATCTTCCTGGACGAACCGTCGACCGGTATGGATCCCGTGTCTCGCCGCTTTATGTGGGACGTCATCGCGGACATCTCCACTCGTGGCAAGG
AATCGACTATTGTGTTGACGACACACAGCATGGAAGAGTGCGAGGCTCTGTGCTCGCGTGTTGGTATCATGGTTGGCggtcgtcttcgctgctaCGGAAG
CGTACAGCACCTGAAGTCTCGGTTCGGCGATGGTCTCGTGTTCGATGTAAAGCTGGACATGCCGAGTGCTGACGAGCTCGAGTACCTGGTGCAGCACATT
TTCGGCAACGGCAGCGAATTCGTCACACCcgtcgagctggagagcaGGTGCCGTTCGTTTGGCAATGCAGACCTTGCTGGCCGCGTGACGGCTTCACACC
CGACTGGATACAGTCTTGCTGCCGCGATGGAACGAGATGGGTTCATCCGCGCAGAGGCCTTTTGCTCCTGGTGCGTCGAGGAAACGCGCTTTGACGATCT
GAACGACTATCTTGTGCGAGCTTTCGGTGCCGACCAAGTCGTGGTGATGGAGCGCCAGAACGATTTCGCTCGCTTCAAGGTGCGCAGCCCCAACAACGAA
GTGAAGCTGTCCAAGATGTTCGCGCTGGTGGAAGACGTCAAGACCAAGATGCACATCCGAGAGTACAGCGTTTCGCAGACaacgctggagcagatcttca
actcgttcgccagccagcaggaagaggagcAGGGAGCAGTTCGCGGCGTCTTTCA