Description :
From Genome Similarity Track
Location :
scaffold_1192:3- 3196
Transcript NameFunction/comments
g11142.t1hypothetical protein

Sequence
3193 bases(100 bases per row)
GGGGGGTCGTCCAGCGCTGTCGTCTGGAAGTTGCCCGAGTGGTCGATCCTCACGGCGGCGTCTCAGTACGCGACCGAGATGGCCGTCAACGAAGCCGAGT
TCCATGGATTGCTTCTGTGCCTGGATCTCCTGTCATCTTTCGGCAGAGGACGCCTGGTGATCTGTGGGGATTCCAACTTGGTGATCCGGCAGATGCGGGG
CGAGATCGCATGCAAGGCGCCAGCATTGCAGCTCGTGCGCGAGAAAGCGATGGGCAAACTCTCGTCGTGGTCTCAGCACGAGTTCGTGCACGTGAAGCGG
GATTGGAACCAAAGCGCAGATCGTCTCGCCAGCGAAGCCTTGCAGGCGAACGGTAGTGACGTCGATGGTGATCTTCGAAGACTTGGTCACAATCAATCGG
CTTGGAGAGATCCTGAAGCCAAAGAACGATGAGAGCATGGTCCGTGTCTCCGCAGTCACTCGATCGTCCACACGGGCGTACTCCACCGGAATGCCTGCAA
GAATCAGTGGTTCAAAGCATGAGGTTAGAATGCGTCGCCAAAGCGCAAGCCGAGGAGAAGTGGATCGCAGATTTGAAGACGTATCTGACAGGGGACGTGG
CGGATCTGGCAGCGAAGGACGCTCGGACTTGTGCGAAGATCGCTGACGCGTACGAGGTAGATGACGATGGACCCCTGCTGTATTGCCCGATCTCCACGTC
CAATTCGGACGAAGATCGCGACACGATCGCAAAGCTGGTGATACTGGAATTGCTTCGCTAAGACTTCCGACATCACTATCATGCGAGCGGGTACGTGCTG
GCGAAAGCGAGCAGCACCCGGACCGCGCAACAGACCGCCGAGAGCTATGAAGAAAGTGTCTTCCGTCGGTTTGGGGCGAGCGAAGTCATCCGGCACGATC
GCGAGCCCGGGTTCATGGCAGATGTCTTCCGTGTGTTCAATCGTATCGTGAGCCAACGACAAAACCCGACAATGGCTCATCGTCTCCAAGTCAACGGTAC
CGCAGAGCGTATGGTGCAGGCGCTGACTTGATCAGTTAAAATGTTTGTTGCAGACATAAACCAGAAGGACTGGGACGAGCACGCCGAGCGGCTGACGTTC
GCGCTGAACATGACTCAAGATCGAGTTCGGGGAGACACGCCGTCCTTCCTTGGCCATGGTTGGGATCCGAGATCTACGTTGGAGGCGGCGTTGCCCGTGG
GAAGCACGCCTTGCAGAGATCGCGATCCGCGGAGATGGCGTAACCATGTGCAGATCCACTACCAGCGAGCCCCCGAAGAGGTGAACGAACGCCTGCGTGA
AGCCATCCGCGAGCAAGCCGACCATCACAACGTAGATCTTCGTCCACACCACATCGAGGCCGAGATCAAGTCTGGTTGTATCTGGATCGCGTCAAGGAAG
CTGGCGCACCTCTGGCATAGACCATTCCTCCATGCTGCTGAGATGATTGACCAATATGCTGCGAAGTTGAAGATCGCAGGGACTGAGAACCGGGTCTTCC
CGAGCGTACACGTATCAACCCTCAAGCAGGTGAAGCAGTTCCCTGACCGGTTGAAGCTGGAGATCGTCGCCCCCGATGAAGATCGCGTGAACTTCGATGA
TGCCTTCTTGCCGGAGGACAACTGGGAACGAGAGTTAGACGAGAACGAGGACGAAGTAGAGCGAATTGCGGACGTACGATCATCTCGGAAGACGCGATAC
AGGCGGAACTGCCGCGAGTTCTTGGTGCACTGGAAGGGGTATGACGATCCGACGTGGGTGGACCAGGTTGACTTAAATTCTGGAGCGTTGCTCCGCGAAT
TCGATAGAAGCCAGGTCAGTTGCAACCGCTTCGGCGTTATTCAATCCCACGAAGAAGAAGTGGGTGGATCCCCTTCGCAGTAGGTGCAAAAGGGGGAGAG
ATTTGTGCGGGGAGGCTGCACAAATGGAACGATGGGTTATTTGTTAATGTGAGTACAAGAGGAGACATCTCGGGGAAATCTCCCAACTCTACCCGAGAGG
AGCTACATGTTGAGAACTAGCTGCTCAGTCGCTATCGTCTGCGGTGTATAGCTTCCTGTCGAGAGTATGAGGTGAGATCCGGGGTGATCCACAATGTTCG
CGCGAGCCATGGGCCAGCAGCGTCGACAATCTGGAGAGCCGCTTGGAGATCAGCGGGTCGCTGCCGCTCGCCGAGGCCCGGATACCACTGGACCTTCTCC
ACGCACCGGGAAGTGTAAGAAGTATGGGTCTAACAGGAAGTCCAGATCGCACGAGCAGCCTCCGCCACCGAGGCCCGGCTGCGTTGGCGGTAATCGCTCT
GGTATCGGTCCAAGTACGGTGTCGCCGCACGCACAGCGGCCCTGAGAGGCAACTTATGCGTGGTCTCCCAGAAGTCTTGGAGGTGGGCATCTTCGAAGCT
TGAGTTGAGGCGACAATACTCAGCGAACCACCCGTTTACCTCGAACGACCGCGGGATCACGAGACGCCGCATGGCGCCCCAAGGAGGAGGCGCAGCAGCA
TATAGTGCGGACGTTGGCTTCGGTAATCAGGTAAGGGGACCACGCGCTCGAGCGAGGAGCCCGCACGCTCCGTGGGAACAGCCAGAATTTCGGCCGCGTC
CATAGGTTGAACCGTGCGTCGATGCGTAATCGTCGGATGCTTAAGCGGCTGACATCCTGGAGAGGCCATGGAGCGCAGTCGGCGGCGTGGGCGCGTAACG
AGCGGATCGCCTATAGCCCGGAATCCACTGATCCTGGGCGATCGCGGTCGGCAGGATATCGCGATGGACCTACCGCAGGAGACTGTTGTCGGAAGCGTGG
GAAGACAGCGAGCTTGGGCTATCACTGCTGTCACCTTGTCCGCCACCGTTTGAATGGCCACCTCCGCTGCTGCTGTCGTCACTGCTACCGCTACTAGTTG
GACTGAAGCCCCCAGTGCCCGGGCCGTGAGGGCCAGGATCCGATTCCTCATCGGAAGAACTGCTGGAGGGGCCTTCGTCGGTATGATCACCACCGTGATC
CAGAGAGCCGTCACTTTGAGAGCCACGTTTGCCACCGTGATCGCCAGAGTCGTTTCAAGCATGATCGCCAGTGCCATGTCGGTCAGGCCCTCCTTGATCC
CCGGCATCACGTCGACCATGATCACCTGAGCCTTGGACGTCATCCGGCCCATCGTCGTCAACAGTGATGGGATCGCTTGATGTCCCGCCGGTG