Description :
From Genome Similarity Track
Location :
Scaffold_478:3- 3183
Sequence
3180 bases(100 bases per row)
TTCTTCTGATCCCTTGATCCGTCTAAAGTTCTTGCCTTTGTATGCTTGCCGCGTCCGATCACGGGCTAACTTTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGTGAAGCAGTAAACCTTGGCGGCCACAAGTATTCCATCCCAG
GGGGATTCTGACGCGTATCTTTTTTAGGAAAATTAATACTGTTCGTTGTTAACCTATTAGAGCTAGAACTACGCTTATCTGTATCTCAGTTTATGTTACA
TCGTTTGCCCCCCTCCATCCATTCCTTGGCCTTGAAGTGACCCACATCAACCACCAGTATGACCAAATGGTCATCGACAGTGACCATGACCGATGGTCAT
CANNNNNNNNNNCATCCATAGTGATGATGACAGATGGTCATCCATAGTGATCATGACCGCTAGTCATAGTCAGTGACCATGAAAGATGGTCATCAACAGT
GATCGTGATCGATGATATAAATCCCGTGATCGTGACTGAAAGTCATGACCCGTCAACTTCCATCTTAACGTTGGAGATTTTCTGGCGGTCAGTCGCAATG
CCTGCTTTNNNNNNNNNNCTGATGCCCAGCCAATGTCCGTGACTGATAGTCATGACCAGTCAACTTTTCACTGTACCGTTGGATATTTTTCTGCGGTCAG
TTCTAAGGCCTTCGTGACCGGTCCCACATGAACCCATGGTGTGACAGGATGTGATTGGTCAGGATTTCTCCTGACCAGTTCATTACATTCCAGATGTTCA
CGCCGGTACGTGGGCGATTCATCTCGAATCCAAATCTTCACCAAAATCGCTGCGCCTTTAAACGGTACAAGTATTCAAAAGGAGAATCACCCGCTCGCTT
CCTTGCATAGTAGTATGTCTTTCTGTAGACATTTCGTATCCTCCATAATGTATCATAAATCTATACAGCATTTGTTTCCACGATTAGCGTATCGATCGGC
TGAGTTTACTATGCCAGTTGTATGCTAGACCAGTAAAGAGTTCGCCCAACACAAGGCATTTCTCAACCTCGGAAGATTAATCGCGCAAGAACGCCAAATT
GACCTTGCTTGTCTAGATCCTCGCACGATCTTCNNNCTTGTCTTGTCCATTACATTCCTTCAGGTCTGCAATTCCAGACATCCGAATCCGCTGAATATTA
AGTCCTACAATTGATGTCGTATATCTGCAGTTGCCACCAGTAGTCTCCTTAGATTGTCGTCCACTAAAATATTTAGGATTGCAGTTTTGAGGCCCGGTTT
GACGCAATCCCACCGATTCCTTTTCAACATCAGGGGTATACTTCTCTGGCATCATCGTGGGGATCGACGATTGACTAGCGATCATTTGGGATTGATCTTG
CTCATACATTCCTCATGGCCGCCTTGGAGTAAGGCTCGAGCTGGCCTGATCCTTTCGGCTTTATGTCTGACAGTTTAGGTCCGATTGTCGATCGCACTTC
GGCCTTGACCAGTAACATTCGATCGCGTATAAAAGAGCACCATTCGGGAGGAGATACATTCGTTGGATTTTGATCGAAGTTTCTGAGCCCGCCTTTGATT
CGACCGACGTGTACTGTGATGATCCCGTGTGACATNNNNNNNNNNCGAAGGTCGGCGATCGCGTGACTTGCTGAATCACGTCATCCGGTGAGAGGTACCA
AGTTCACGAACAGCGGTCTCCCTGCGTGNNNNNNNNNNACCGGTACCATAGGTACCTATGGTATAACAAGATGCGATTGGTGAGGATATCTCTTAACCAC
TTTACTACAATCGTGGAGTTGTTGATCGTTCGGCGGTCGACGGAGAGATCACTACCCTATATCAGGAGTTGTCTCGATACCGAGAGGTCTTAGGCAGCTG
AAGCACCATAGGACGCATGTTGGACCAACCGGCCGTACGGAATCGAATATAGAGCACGACCTCGAATAGCCTTATTCTTCTGCTTCTCAGTTTTTCTAAT
TCGAAAAGACATTATGACAGGTTCCGTGCCCAGCATGAGGAAGAGTTCGTGCAATCTGACTCCTTTCGGAAAGAGCTGGCTGCTCTTTTCGACCAGACAT
CAGATATCACGCATTTGAAGTTGGTGCTTCTTCAGGCTACACGAGTGCGCCATATCGCGTAAGAGACGTTGAACCGCAAAATAGCGGGTATCCGGAAGCA
GATATATGAAGTGGACGGTTGGCTTGTAGCCAAAATCGACGTGCACGCCGATATTTTCCACAAAGCCAAACCGAGAAGAAGCGTTACAAAAAGGGTTGTA
CTGTAACTACGGTAAGCTCCACCTAGCTCTAGAGCGTCTAGAGAAACTTTAAGTGTAACATTGCCAAAGTCAAGATGCTATGGATACCAAGTGCGCCAAA
TGATATCGCTTACACCACATATTATCCAATCGTTACGCCAATTTCGACAGCTACGTGCGCAACTGGCAAACATGGCTTCTAAGCGTAACAGAGCCGTTTA
AGATCATAATTATTTGCGAACTCGCATGGCTCAGTTAGTAACTGGGAAGCCTCTTTATTCGGGTAAGAAGTCGGTATCGCTTATATTCGGGTGCGAAGTC
AGCATCGACTTCCGGCAACCCAAATCTGCAAAGTATAAATACGCATCAAATCCTTCGAGACCATGTTGTAAACGACCGCTCGATACCTCATCGTCCTCCG
CCATGCCTGATCCGACGAGAGTAACTCGTCTCGTTGCTACAAAAGTTGGACCTCGCTGCCTCACGATCCCAAGAGACCAGCACCCCCTCCTGGTCCGGTG
AAGCAAAATAACCAAGCTGCAAACCGGCCTTCTTCTGGGGACGAATAACCGTTTTATTTCGAGTACACGACATTTGCCTCCCCCTCTGTACTGCTATTTT
CAGATCGTCGTTCTCGCATGTCGTCGACGTCTTCACGTCTTATGCCCAGATCGTTAACGACCAGGTCGTTATGTACCCACCAGCCCCCAGATTGACGCCT
TATCTCCGGCACCAATTCGACGGACGGACGTGTCTAAGGTGTTAAGGGTAGATCCATTTTGGGAAGCGGTCATTGATTTTGATCGAGAAATATGCTCCCG
ATAAAAAGCGCGAGGATCGAAGAATTAGCTGTTACGAATCGCAGATTACGTCAATCTGCCTGACGTCAAGATTTCCCGAG