Description :
From Genome Similarity Track
Location :
Scaffold_2214:3- 3156
Sequence
3153 bases(100 bases per row)
GAAATTCACGGTAAATCCGTCCCATATCTAGTTCGCTTTCCTGACCTCATGTCGGAGATCCCCTTGACTCCGAACTCGTCAGCTTCGAGATACACGTCCC
AACCATCCTCCGGTAGGAGGACTTCGTCGAAATCCACTCGGTCGGATTCATCCACCGAAAGATGGATCTCAGGCCTGTCCGGATATTCTCTGACCAGCTT
CAGCTTGGATACGTGTACCACGGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAACTTCATCTCATGTTCCTCAATCTTCTCACTTACTCGGAACGGT
CCGTGCCAGAGATGGGCCAGTTTACGGGCGTACCCTTCCTTCACTCGATCTAAATAAAGCCACACCCGCGATCCCACTTGGATTTGATGCGGACGGGCGT
CTTCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCA
TCGTCTTGGATCTCGGTTTCTCTTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGG
GTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGAACATACATCT
TGAGTGCCCTCGTGATCGTCTGTACCATGCGTTCGGCCGATCCATTGGCTTGGGGACGATATTCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTT
GAAGGCTCGAAAGAAATCAGACATAAATCCTGACTCCCGATCATGCCGAATCATCTCACTAGCTCCTAATCTTCGAAGAACGCACTCCTCGTACGATTCG
GCGATGGTTTGTGCAGTTCTAGACGCGCTAGCTTTGGCTATCACATATCCGGTAAACAGATCTATCCAGATCAACAACTCTGTGTTTCCTTTGAACGACT
TGGGTAACGAGGGGATGTGATCCATGGCTATAATTTGGAAAGGGTAAGTCGCTTGGACATTGCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCC
TGTCTCACAATCCACACATTCACCGAAAGAACTATGCACGCTCTTGAATAGTCCCCTCCAGTTGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATA
CCCTGATGTCCCCCTTCTAAACTAGCGTGGTAGTGGTGTAGGACATCCTGTTGTAAGGTTTCTGGCATCACCAATCTCATCTATCCATCCCGATCCTCGT
GGACCCTCTTCGTAGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCCTCCCGACTCA
AGTCTCGTACATCCCCCATCAGATACTTCTTCAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCATGCGGACTCCCTTCACGAAT
GTTTCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACCACTACCACTT
CGTCAAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCAGTTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAAACTATCCG
CACTGGCATTCCAATCTCGCTTGACATGTACCAACTCGTGATTCAACCCAACCACGCAGGTGGATCATCACTATCTGCCGTAACAGTGTTAGGGCCGGGG
CCTTGCAGTCAATCTCACCTCGCACCTGTATGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAACC
CAGATGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAATTTCCACAGTATT
GCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGAT
CCGGCGTTTGGGCTCTTTCTTAGGGGCGATCATAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGGGTGTTCGCGGCCAGAATTCCCAGATTTTTTTTTT
TTCCCTCTTGGGACAACTTTAAAACATTTCAAATCTTGCAGAAGGAAGAATAAAAAGCCACCCCGCCCCAAAGTCCCAAACGTCCTTGCAACCCGGCCGA
CTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTATAATTTAGATCCAACACGCGCAGGAGCGCGAGT
ATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACAAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGCACCAGAG
CTGCTGAGACTGCCCAGTCACTGGCATAAACAATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGCTCCTCAG
TTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCAAGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCT
CGGAGTGGATCCAGCTCCTGTGTTAGGTCCTCTTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTCGTTGGATTT
TCATCTGGACAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCTTCGATGAACCGACTGTA
GTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCAGCTAATGAAGACAGGTCCTTAGGATTCGCCTCTAATCCC
TCCTTGGAAACTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTATCCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTA
GGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGAAATCAGAATG