Description :
From Genome Similarity Track
Location :
Scaffold_1083:3- 3121
Sequence
3118 bases(100 bases per row)
TTCCCCCCGCCGCCCAAATTCCACCTCCCTCGTCCGCCGGAATGTAAGCCCCTGGCTTCAACTCTTCTTTAAGAAGTTGCCAAGACACCAAGGAGTCGCT
CGAGAGGGCGTCTGCCGGACGAGATTACGCGCTTGAAGAATTCGTGCGTATGACTCGATTGCGGGACGAGATCCAAACGAAACTGGCAGACAGCGAGCTC
CAGCGGGACAAGGCGACTACCGAGTGGGCGGATGCCGAGCGTGCGCTAACGGAGCTGGAATCCAAGCTTCGCCGCATGAGTACGTGGATCCTCTTTTAGC
CCTTGCTAGTAACTCCATATTCACTTGTTATTGTCAATCTAGGTGACAAATTGAGGAAAGCAGATGCGACCACCGCGAAACTCCAGGATCAACTTTCCGC
AGCCCAAACTCAGCAGCAACAGCTGATCCTGGAGCGCGATCGCGGCCTGTCGGAGCGCGATTTGGCACGTCGACGACTGGCGCTGGTGACAGCTGCCGTC
TCGGACCCACTTCCTCCCTTGTCGGGGCCCTCTCAGGCTGCTAGCGTTTCTGCTCCTCTTCCGACGGTAAGTGGGGCGGATTCGTCGACTGCGAAACGCC
CGCGTAGTACATCTCCCGCTCCTAGCACCGGATCCTCCCGTCCCCATAAGCAGGCCCGAGCTTCCCCGAAAGCCAAGCCCAAAACGACTCCGGTTTCTAA
ATCTGCTCCGCAAGCGGGATCCACTTCTGTGTCCAAGGCAGGATCTACACCCGCGCCCAAGACTTCCGTTTCTCCCTCGAAGTCAGGTGCCGGATCAAAG
TCTGGATCCACCGCTAGATCCAAGTCTACCTCGGCGTCCAAGACTGGATCTACCACTACGTCCAAGTCTGGCTCCGGACCCCAGACTGGGTCTACGGCGT
CCAAGACTGGACCCGTTGCTACGTCCAAAACGGGATCGACGGTGTCCAAGTCTGGATCGACGGCCAAAACGGGATCTACGGCCGTATCCAAACCGGGATC
GACGTCCAAGACGGGATCCACCGCTGCTGCGTCAAAATCTGGATCCGGACCCAAGACTGGGTCTACGACGTCCAAGACTGGGTCTACGGCCGTATCCAAA
CCGGGATCGACGTCCAAGACGGGATCCACCGCTGGTCCTTCGGTGACGACGCCCGCCGTTCCTCAGTCCGCTTCCACCAACCCTCCGCCGGCCCGTACTG
GACCGGGGAAGGGGAAAGCTAAACGCGTCATTCCTCCTGGGTGTGGACTGGGTAGTTCGGAGGACGATGAGGAATCTGACTGGTCCGACGGCTCAGGGCC
TCCTAACCGATCGTCGTCAAAGCGTACGCCGTCTGCCGGCCCGTATCCCTTCACTCTAAGCGATGAGGACGATGACGACGACGACGATGACGACGAGAGT
CCAGAGGATTCAGAGGAGGCTCGAACCGCTGAGGAGGCCTTGGAGGAAGACACGCGGCGGGCTCTATCCCAATCCCGATCCGAAGCCCGGCGGAGATCCC
TCTCAACGCCGCCTCTACAAGTCGCTGGCACAGCCGGATCCGGAGGCGACACTGCGGGATCCGCGATCCAAGTCGACAGTGACGGCGGATCGGGTAGCGA
TGGTGGGAGGGGGTCGCCTCGTGGTGGCGGACTCCTTGGATCTGGCGGAGGGGGGTCGCCTGGTGGCGGGTCCCCCGGATCCGGTGGAGGGGGGGTCACC
TCATGGTGGTGGATCTCCAGGATCGCCTCATGGTGGCGGATCCCCGGGATCGTCTCACGGTGGCGGATCCCCTAGATCTGTCTTGATCCCCGCTCCCCCT
AACTCATCACTGCCAGGGATGCTCCCCGTGGCTCCGTTCGGTCCGGATGCCGCCTTCATTCCTGGTAGACGTGCCCCTGTGGCCTTCGCTACCAGAGACA
TCGAGCCTTGGTCCGCCAAGAAGTTGAACCGGGTCGCGGTCGTCTCAATGAACCTGAGTTGCCTTTTCGAGCTGAGTGGATATTCCCTCGGACGGCGGAC
GCCATCCCGAGGGCCGGGTACCTGGATTCGCTCGTTACCAGACCTCTCGTGGAAGAACTGACAAGTGCTGCCCCGTGGGATACGCTGGCCACCACACCGG
TGGATCCGGTTAGCTTTAGGGATGATGTGCGTGGGCGACTCGGGGTATTCGTTCGTGCGTTCCGGGATTTCGTCTCCAAGCACCGGGTTGCTATATGGGA
GGGCACTCACCGGTTCCCCATCTCTCGGAATCAACTGCAGGGTTCGACTTGGTTGTCTAACTTCAACAAGCAGCGTGGTAACCGACGTAGCCATGCTGGC
CGAGCTTGGAAGAGAGTCCTTGTGATCCTCGTGCTGGCAATCCAGGACGGTTGGTGTGACGTGGATATTTTGTTGGATCCATCCTTCTTGCATCTTCCCC
GACGCGGGGATAAGGTGGCTTGGTTTCCGGGATCCGTATCCCGTCAAGCCAACTTGGAGGATCCCAACCTCCATCGCCCAGATCCCACGAGCCTATTGGA
AGCCTTGCGAGAGATCGACGAAGCCGAGCCTTGGCGTATCCAGTTTCGCGGGGACTTGAGCCAACACCCAGGACGCCAGGTCCAGCGTCTAGTGGGCAAG
TTCTTCAACGTTCAGCTCAAGACTACCTGATCCTCATCACTCTTTGACGTCACGCCCCCAGTTTCAGTCTTCGTGGATTCATTTTCGTAGCCGTAACTAG
CGACTGGAAACTGGGTCTAGCTAGCCCTTTGCATAAGCTATCATAATCCACACTCTCTTACTTGAATATGTCTATAACATTCCCTCGTTGGTTGAGAAAT
CTAGTCCGGGCCTTTCAGTGTACACCTGGATCTGGGCAGGATCCACCCTTTCAGTGTACGCCTGGATCCGGGCGGGATCCACCCTTTCAGTGTACACCTG
GATCTGGGCGGGATCCACTCTTTCAGTGTACACCTGGATCTTGGCGGGATCCACCCTTTCAGCGTACACCTGGATCTGGGCGGGATCCCGGATCCGGTTG
GATCTGCGCCTGGATTTCATCCGGATCTAGCGCCAATGACCCAGGATCAATTGGGTCAGTATAGTTGGGGCCCTTGAAAGCTCGTGCTTGAGATCAAACA
GGACTCCTCGCACGTAAA