Description :
From Genome Similarity Track
Location :
Scaffold_2172:3- 3057
Sequence
3054 bases(100 bases per row)
CGCGTCGCCGACATTGATGTCACATTTGACTCCGCGGGTGGCGCGGCTGGTAATGCATTACCTTTACCAATCAGCAAATGTCGGCTTTCCCAGATTTTCT
GACGTAACCGATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGGATATCGTCAATTGTGACCTCCTCTGTGGTCAGTGGCACCTCCGGGATTAC
CGCCAGGCCATCCCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAA
CACCGCGACCTGGCAGTCCTTCTGTCTTCGCGGGAAACATGGACACCTGTATATCAGGGAAACACCCAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAA
GCCCGACCGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATTCAGGCACTTATCCAATGGAAAGCTTGGATCCACTTGTGAATCAGCGGGATCCG
GCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAGGGGCCGACTCTGGGGATCATCCCCGGTCTTGGATCCAACCTCCCT
TGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTGGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTGCGCCGGGAGCTCC
ACCCCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAG
GGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACC
TGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCTGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGTTCCCAGGTTTCC
CCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTTGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGA
AAGAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAAT
GTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATC
CGACTCCCATCCACTTGGCATCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGT
TGATCTTGCCCCCTACCATGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAAC
ATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTC
TCCCAATAACCACGTGCATCTCCCCTTTGTAGATCCATGGTTGAAGAGATTTCGGATCTGGCAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAAC
TGACACTTCATGTAGATCACATGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATTTCTTGTTCACAAATGCATAAATGCAATACCTA
GAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCGTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAA
CCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGA
TGGCCTTTCTTGCTACACTTCTCACAGACCAGGTGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCC
CGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACAGTATCCCCCGATCGCGAGTTGTCTTTGGTCTTCGCCGTTCGATCGTTGGATGC
GGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGATCCGTCGGATCCTGATTCAGTCCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGA
GCTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACCT
CTCAAGCTCGTCTGCGTCGGGAAGTCGTACAGGTCAGCCTGTCGGCCATCCTTGATCTTCAATTTGGCCGTAGACCGGCCACATTTAGTCGATGTAGGTA
TTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAAGCCACAGTACTGGGTCTGGAAACTGCGCAGCAAA
TCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAACAGATCCGCAAAGGTCAAACACTTCTCAGCATCCG
ACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATAT
GGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGATCCGGCTGTGGCTGTTGCTACCACCGCTGATGAAGGGGATGGGCCATCCAGATCATCT
AGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTC
TCATACCCTGTTCGACCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCA