Description :
From Genome Similarity Track
Location :
Scaffold_27:3- 3052
Sequence
3049 bases(100 bases per row)
GTCCTTGATGAGAAGACTCGGAATGAGCGATTCACATCCCAATCGAGGGAATCGCTCAAGACAAATTCTCTTTACGATGATTTGATGGAATTCAGATGTG
TTCCCAGAAACAGTGCCGTGCGAGTACCTAAGCACAAAGGTACTCGTCACGACATTGACCTGAAACTGAGTCAAAGTACTGTTTCGTCAAACAATGGCCA
CTGCCTCGTGAACAAGTACTAGCAATCGACAAATTCTTTGCAGATCGCTTAGCAGCCGGCCATGTGAGGGAGTTCATCTCTTTACATAGCGCTCCGACCT
TCTGTGTTCGAAAGGCCACAGGAGGATGTCGGATAGTACATGCTTTCAACAAGTTAAATGCTGCTACTGTACCAGCTCAAACACCAATACCAAGGAAAGA
TGTCATCATATATGGTATGGCAAGAATATCATCATTTCATCAATGGATCTGATTGGTGGATTCTACCCCTAATGCGCGAAAGGGACATTCCGATTACTCC
AGTGAGCACCCCAAGCGGTATTCTTTGGGAGTGAGTAGTAATGCCACAAGGTCTGATAAATGCTTCCGCCACATTCAACAGATGTGTGACGAATCTGTTA
AGATCCGTAAAAGAGTTCGCGCCCAGCTACTTCGATGATGTGTTCATCCATAGCCGGGCTATAGACGGACAGACGGATGTGGAAGTGCACCGACTCCACG
TCCGGAAGGTTCTTACACAAATGCACGAGCATAAGTTGTACTCCAACCTCAAGAAGTGTATATTTTCTGCCAGCGAAATACCACTTCTTGGTTGCATCGT
GGGCAATCATGGCGTTCAGCCGAATATAGAAAAGGTCAGGATGATCAACGACTGGCTGTTGTCTACAGATGTCAAGAGACTTCGAAAGTACTTTGGCCTA
GCGGCGTATTTGCACAAATAACAACGCAATTACGCCAAGATGACTGTTCATCGCTCTAGTTTATTGAAAAGGAACGATGAGAATGGAGTGCCAATAGCCA
GTGCTTTTTCGAAGCTATCAAGAAAAGCTTGGTACGATCGCCGGTTTTAGCAATTTCAGACAAAGACAGGCCATTCCACGAGGTCTGTGATGCCAGCGAC
TTTGCAATCGGCTGTGAATTAATGCAGTACGATGCAGAAGATGCGGAGCGTGTCGTCTATTTTTTAATCACTCCAGATGCAGCCAGCTGAACGCAACTAC
CCCGTCCATGACAAGCGACTCCTTTCCATGAAGTACGCGCTGACTAAGTTCAGAGTCTATCTTCTAGGTGACAGACCCTTCATCGTTTTTATGGATAATG
TGTCTTTACGCACAGCCATAAACAGTCCACCCCTCCCGCAGAGGATGGAGGGGTGGCTGTCATTCTTCGCAGATTATATCTCCTCCGTCGAGTATAAGCC
AGGAAGAATTTATGTCGACGCTGACGCACTCTCGCGCTGGCCCGATTTCGAACCGGCTGCGCCACCCGAAAGTGGTCCGACCACTGTCGCGGTATTGAAT
TCGAGTGTCCCGTCATCAACCTTATTGGAAGCCATACGATAGTCGTATGATCTGGAGATGGTGCGTTTGATGCATCATCTCTCGCAACCATCCGAGTATC
CAACAACTGTCGCCAGTATATCGATCCTCTACGCATAGATATACAGTTCGCAACTTCTTACTCCAATCTTCGGCTGTTTCCGGCGACACGCCTCGTGTTG
TTCTACTAAATCATGGTGATCTGCGGTTGCGTATCATGTATGACTATCACGACGCACCTGTTGGTGGACATCGTGGTTGTGAAAAGACATATCTCACCGT
GAGTTGCGACTTTTACTGACTCCGCCAGTATCAGCTCGTGCGCAATACGTTCAGGCCTGTGAGGTTTGTCAAAGGGTGACGTCTGGTCCTTTCCTTCGTG
CCCCGTTACAGCCTGTACCCGTCTCGGCAGGGGCTGGGACTCTATCTTGATGAACTTTTTCTTCGGATTCCCCGCTGACCCACACAAGAATACTGGTGTT
CTTGTGTTTGTTGACAGATTCAGCAAAATGGTAGATCTGGTTGTTGTACGTGAACCAATTAACGCATTGGCCTGTGCCCGCGTCTTTATCAACACGGTCT
TTTGCCTTAATGGGTTGCCTCGTGAACTCGTGTCCGATCGGGACTCGCGGTTCACAGCTGAGTTCTGGCGTTCGTTTTCAAAAAAATCGGAACACGCTTA
TGGATGCCCACGTCTGACCATCCTGAAACAGATGGTCAGACCGAACGCGCCAATTGTGTCTTCGAGGAGATCCTTCGAGGATACGTTCATTCGTTTACGA
ATTGGAGCGAATTCCTGCCGATGGTGGAGTTCGCCATCAACAATTCAGTTCATGCGTCAACGACGCACACGCCGTTCTTCGTGAATGGCTTACGCCATCC
GCGTCTTCCCATCTTTTTTGAGTGTGACTTTTGTTGAAGGGGTGAGGAACTCATTCGAGCGACCGTCAATCCGGCTCTCACTCGTCATGTGCTGACAATG
CGGTCACCACGTTCGACGCCGATGTAGATCACATCGGCTTTGGTGAAGAAGACGAAAGTAAGAGCGAAGATGCTCTTACTGGACACGATACTGATCAAAT
CAGCATCACGCCTAGTGCGTCCAAAGACACACTCACAGAGGCGACAATTGATCTTGCTACAGTACGCTTCAAGAGCACTGCAGCTAAAGACAGCGAGTCA
GCTGGCTCGCAGAACGGTTTTCCGTTTCGTACAAGACTCTATCGCAGAGGCGGTAGATCGACAAATATAAACGCTGAAAAGAATGGAAGGGCAAATGTTC
TTTTATTCTTTAAAGGCGACTTAGCCCTCCTATGTAAGGTAAACCTACCTCAACACATAGTGACTAATGTGGGAAGTAACAAGTCACTACCCAAGTTTAT
CGGTCGATTTCGTGTGCTGCGCCGCCTAGGAAACGCATATACGATTGAACTGCCACGTAAGATGCGCACGCATCCTACGTTCTACATAGGTCTCCGAAGG
CCGTACTATCAGTACGCGGCTTCTTCCGGTGAAGAACGCCATTGCGTTC