Description :
From Genome Similarity Track
Location :
Scaffold_2522:3- 2962
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2522-fgenesh-gene-0.0AP-3 complex subunit delta

Sequence
2959 bases(100 bases per row)
CGACCAGCACGGTCGCGTGCTCGGTCGGAAAGTGCCGAAGCACGAACTTGACAGCTTCAACCTTGGCCTCGCGCACGAGGAACGCTGCGAAGACGTCGTT
GAGGATGCCTGTCGCTAGAGGTGGAGCCGTCTGCGCACCGCGCAAGACAACCACCTTAGCACTCTTGAAACGGTTGAGTGCGAGTAGAGATTGGACGACA
CGTATGTTGACAGGCATCCCGTGCTCGTCCATCGCCCACGCCAACAGCGCCGCGATCGCTTCGTCGCGATCACGGGGCCGCCCAGCCCTGTTCAAGAGGC
TGCGTGCGAGCGTATCCGGGTCCAGTTGCGTCAGCCGAAACCCGCCCGTCGCGAGGAAGTATTCGATGACTCCTCGGCGGGCTCGGCTGATCGCGATCGG
GACGAGATTGTCGGCGACAACTTGAAGGCTTGGACGGATACCGAGCGCGTCGAGCCAACGCAGCACGTCGAGAGCCCCGTTCACCGGCCCGAAGACGATG
TTCGCAAACGCTGGGGCCACCGTTCGCTGAATGTGCTCACGTCCGAGGTGCTCCAAAAGCACCTCGAGTATTCCAACTTGGTGGTGCAGGCACGCAAGCT
GCACATACATGTCGACGCCTGTGGAGTATAAATCGGGGACGTCAACACGGCGCGCCAGCAGCCAGCTGACCAGGACTGTGTTTCCATGTTCGATTGCCGA
ATGCCCATCGAGAAGATGCGGCTCGCGAGGCTGGTGCCGCGCCACATGCGCAGCAGCGAGTTGGCCGCGCTGGTGTCACCGACAAAGCCAATCGCTTCTA
TCAAGCGCACGTCCTCTCCGTTGGTAATGTTGGGATACTCCTCCATGCTTCTCGGCGCGCGAAAACGGTGGCCTGCCGCGTAGTAGATGCGCAGCGCCGG
AGCGAAGAGCACGGCGTAGCCCTGCTGGAAGGACGNNNNNNNNNNTGTTCCGTGATGTGCCATCAACAACACGCGCTTCGAGCTCCGTACACTTGTCTGT
AAGTCGCCCCACGCTGTGTGCACGTCTTTCACGATGTGCCGAATGAGCCAACACTTGCCTGCACCTCCTTCCCCGTTTGAAATCATGTACATAGGTTCGC
ATGGAGAGCGAAGATTCATTGTTCAACGTCGTTTCCGCGTTTGGTTCATACACACTGCGAAGGGATGCATTGTTCATCAGACATGTTCTCACCCTCGCTT
TTGATGGGACAGACGTATATTTTTCGTTGCGTGCTATCGCCGTGATAGGAGGGTTTCGTTCCAGCTTGAACGGCTTTAGCGTAGCCCTGCTGGAAGGACG
TCACGTGCTGCAGCAGCGATAGCTGCGTTAGCACGGCGACGGCGGCGGTGCGGTCGAGCGGAAGAGGAGGCGGCGGAGGCGGTGTCATGATGGCGCGGAA
GTTGCCGAAGGTTTCCGAAGTGGGGAAATGGGGGCGGGTGAATTGGGGGCAGCTATGGAAGGGAAACCAAGTACAGTCATACCTCGCTTTTGATCGGTTT
CTTATATATAATTAATACAAGGATTATCCATCATGAAAGACCACGTAGTGTCCAATATGATTATATACTTTATACCTTATCGTGGGTTATGTCTTTTCCG
GGGATATAGAAAGCGGGGTATGACTGTAGCGNNNNNNNNNNATGTATCCATCCCAAATACGGTAAATAAAACGGCTCAGCACCTTATTGCTACTTCTTAG
CACTACTTCAGAGTCAGCTACCATCATTCTGGGGAAGCCCGCCCAGTCGGTGGACAAAAGTCCGGCCCAACAAATCCGCAGAAAGATCCGCTGTCTTTCC
TGGGTCTGACCCGTGTTCGGTTTGAAGGCAGTCAAAAACTTCCAATTTGCCAACAAAAAGCCCAACAAAAGCCAACAAACGCCAACGCCAACAAAAACCA
ACGGCAACTTTATAGCGGAGAGGCGCCGCCATGTTCGAGAAGAACCTGCAGGACCTGGTCAAGGGCATCCGCTCGGCCAAGGGCGATGTGACGGTCTTCA
TCTCGCAGGCCATGCAGGACATCAAGACGGAGCTCAAGAGCACGGACCCGTTCCTCAAGGCCGAGGCCGTGCGCAAACTCACGTACCTGCACATGCTCGG
CTACGACATGACGTGGGCGGCGTTCCACGTCGTCGAGGTCATGAGCTACGAGCGGTTCGCCCACAAGCGCATCGGGTACACGGCCGCGTCGCAGAGCTTC
ACGCAGTCCACGGACGTCGTGCTGCTCTGCACGAACCTGCTCAAGAAGGAGTTCGGCGCCGTGAACGAGTACGAAGTTGGCCTCGCGATCAACGTGCTCG
CTAATATTGCCACGACGGACCTCGCGCGCGATCTCTTGGGCGACGTCGTCGCCATGATGAACAGCCCCAAGGCGTACGTGCGGAAGAAGGCGACGCTCGT
GCTGTACAAGGCGTTTTTGCGGTACCCGCAGGGCCTGCGGCTCACGTTCGACAAGCTCAAGGAGCGCATGGAAGAGCCGGACGTCTCGGTCGTGAGCTGT
GCTGTCAACGTGATCTGTGAGCTCGCCAACAAGAAGCCGAAGAACTACTTGGGGCTCGCGCCGCAGTTCTTCCGCTTGCTCACGACGTCGTCCAACAACT
GGATGCTCATCAAGGTGGTCAAGCTCATGGCGTCGCTCGTGCCCGAGGAGCCGCGACTCGCGCGCAAGTTGCTGGACCCACTGGCGACGATCATCCAGAA
CACGCCGGCCAAGTCGCTGCTCTACGAGTGCATCTCGACCGTCACGACCGCGCTCTTGTACACGAAGAAGGGCGACGGCAGCCAGCCGCGCAACGTCGCG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGTGCGCTTGTGCAATGACCACTTGCGCCGGTTCATTGA
AGACACGGACCAGAACCTGCGGTACTTGGGACTTGTCGGGCTCAGCCGGCTCATGGAGT