Description :
From Genome Similarity Track
Location :
Scaffold_224:3- 2934
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.16Transmembrane protein
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.27Conserved gene of unknown function

Sequence
2931 bases(100 bases per row)
CTCGCTATTGCAGgTGGTGTCGCCGGCGTCGCGTTGTtcGTCGACTCCGAAGCCCGACGCAGTACCATCGCACTGTACATTTtCGTGCGCATGCTGGACG
TCgTGGGGCGTCACCTGACTGCAACAGGTGCAATTtcATCATGGCAATACTCGTCCgAGGGGCTGTTCGCAGCAAGCAATGCCGTGATCATGTTTGCTTt
CATTGTGGACCCGACGTTACTTCCcAAGGTTCGAATGGCACGTTCTACCTCTTGGTTATGTAAACACTCACACTCTCTCGCTTTTGTAGAGTTACTACAA
CTGGATCCTCCACATGGGAGCAGTGACGCATCACGGCCTTGACTACACTGTTCGCCAGAGATGGCGCGGAGAAGTTGACAAGCTGGGTCAGCCCCTGCCA
TTCCGTAGCTGTCAACCACACTACCATATGGAATCgTGCATGACACACAACATGAAAGAGTGGTTCAATGGGCTCGGCCGCGCGGTACAGATCTACATGC
CCGTGCACTTCTTGCCAGCCATCTTCTTCAAGTTTCAACGTCTTCAGAAAGCGCCAGTCTCCGCGACGGCAAACATCGCCTACGCTGCACTCTGCTCGTC
TGCCTTCCTAACCTCGTACCAGGTGCGCTGTTGCTTTTCTTGAGTTGTGTCTACTCATATGTCTAATCTTCTGTGATTCTGATGGTCAGACGGCAGTAAA
ATTGACAGTTTGCATGATGCGCAACAGCTTTCAAAACGACTACAAGATTGAATCATGCCTTGCAGGGGTACGCTTTGGATTAGCATAGAGGAGCTATTGT
CAGCAATACTGATATCCTGTATCGTCGCAGCTGACTACAGGCGCTAGTCTCTTTTTCGAGgATCCCAAGCGTCGATTCGAGCTCATGTTGTACTGTGTGC
CTCGAGCTCTCGACATTTTGTGGCAGCTGGGGAAGCGTCATCGCATCGTCCGCTACGTCCAGCACAGTGAGGTCGCGCTGTTTtGCTTGTCCATGTCACT
CATCATGTCGCGGCCTCCAGAGCACTTCAAGCCcACGTATCTCCGCATTCTGCGCTTCCTGTTCGGCCGGACGATTATTTAACAAGTTCGAGATGACtgg
caatgcggTGGAATGATCTTGTCAGGTGAATAAAAGGCTATATAAGAACTTTAAATACAGGCAGGGAAGAGAGTCTGTGCCACAGCCACTCCCTGTTTGT
TTGGCAAATAGTCcTCCTGCATCCTCCTtcTCaaagTACACGCAAGTTCCTCCAGTACATCTACAGACCACGCACAAGCAATCCATCACTCCACCATCCA
CCACCGTTTCTACCACCTACACGTATCCGACCTCTCCATCGTCGTTTGCATCTTGGTCTTGGGGCTGCCATTGTTGCAGTCTTTTCGTCGCGTCGATCTC
AAGagTTCTGTGTCGTTATAACAGGCGACCTTCACCGAAGATTGACTGCCTTGCCAACTCTCTCTCGTCAACAAAGCCATTGTTTCCTCCACCtATGTTA
TGGAGGCTGGACTTGGCTACACCGTATGGAAAACTTGGCTCGTTCAAACCATAtAGCTCGCATAGCGTACATGGTTGCTGTGTGCAATCATCCAAATGCA
GACGGCATCTGTCACTGCGACCCAAGGCgAaGTGATCACAGTGGTCATGGCTGCATCGACGCTCCATCAtGTGGTTGCCGCAGCCACTACTGCCACGATT
CGCTTGGTACGAGCATCCTTCATATGCGCACTCAAAACGATACGAGTGATACTCGCAAAATTGAGGAGACTCGACCAAGTTCTCACATCCTGCatGCCAG
CAATACGTCGCTTTGGCGTGAGATGGACACAACGTCGTCGATGCATTGACCCCTTcAGTGCAATTGGGgAAgCGGCAGCACTGCTGATGGTGTACCATCA
TTGGATCAAGGTGgTTGTtGTCGCTGTTGTCAAAACTTGACGAAGGGAGTGATGGAAGCATAAGGCTTCCGTGTTTGGATGGCACTTCCCCAGACTCCAA
AATGCGGTAATGCCGCTTGCAAAGCccGCGTTTTTGAGCTTGCTTGTCACAACCATCCGCTTTGCAGAAGTACTTCTTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTTGATCTTCGGACTACTTGCCTGCT
TCATTtCGGCCGCgaCTGCCGCGGCAGCCGCGGCGgCTTCAGCAGCTGCACGCTCCTTTTCTTCACGAATTTGCCGAGAGCGGAGGGTGAGTTCGTcAAC
TGATATAGATCCAGCTTGGAATAAGCGAAAATGGTCGTCGCACAGTCCACCTCGAGAAGCCACTTGGTTGCATtCTTTCAACCGaCAAAGAtCTTTGGAT
TTCGTAGTAGtCTTGCTCTGCGAaCCATCACCCCACATATCATTCTCAGGCTGGCTTCCAGCTCCGAGcGACCCGAACTGATAAGGATTACTGCCGCCCG
AACCATCACCAACTGAGACGACAAGAGGaGAAAAAATGTTCTGACATGAGTCgCAGAACTCGCGACCATACGAGGTTTCCTTCGAACAAATAGGGTTATT
GCAAGTCGAAGATTTGCTTGTTCCGTTGAGGTTCACCAATGCTTGTCTCGCATCACTCTCTGCAGCGGAAGATGTCGGACCAGAGCTGACGGACAAGTTT
GCCATACGACCAGTTGTACCACTCGAGATGACTCCGTATCGATCCAAACTATTTCCAAGAACAGAGTTAGGATCcGATGGTGACAGGAACTGTGGAGCAC
TCTGACTTGAATACAAATGACCGTCCCCGAT