Description :
From Genome Similarity Track
Location :
Scaffold_2528:3- 2916
Sequence
2913 bases(100 bases per row)
ATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTACATCGATGTCACATTTGACTCC
GGTGGCAGCGGGCGGTAACGCATTTCCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTAACGCAGACGATCCACTTCAGCAGGTTCATTCGCC
CCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGAA
ATCTCCGCTCTCACGCTAAACAGAACTTGCTCGTCCTTCGCTCTTCGCTAGGAATCCACCACATTGGAATACTCAAACAACGCGCGCCCTCTCTCCCCTG
GCAGTCCTTCTATTCTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGG
TTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAAGGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTA
ACCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCATCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAA
CCCGTCGATCCCTCTGCAGGATCGTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGA
TTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCGTTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTC
GCCAACCGTCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATTA
CGGTCGGCACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCAAGTTTCCTCGGGCTCGATCCA
GGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTGAGGGAAACAAAGTGTCCCA
TCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCACGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACA
CCAAACAACCTGCCAGCGTGATCTTGATCCGCGCTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCAC
TTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCA
GCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACA
GGATCCAGTGACCAGACAGACCTTAAGTGGATCTGCAGTGACCTCACGCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAAACACGT
GCCTCTCCCATTTGTATATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTA
GATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCG
TACCGGATTTAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCT
GGTTGTAGAATTCTTCCATCGGCCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCC
ACACTTCTCACAGACCAGATGTTTCCAGCATCCTGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCT
CGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATTCCCCGGTCGGGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCC
GACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCATTTCCTGAGTCGGGCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGT
CGGAGCCTTTTGGCGATACTTGCTGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCG
TCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGACCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCAT
CCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGGAGTATTGTCG
TGCCACCGACACTCCCAATTTACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTC
CTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGAATTGACTTTGCTTATCCATGTTC
TCGCTCGGTCCTC