Description :
From Genome Similarity Track
Location :
Scaffold_1138:3- 2897
Sequence
2894 bases(100 bases per row)
TGCTGGATGCGTCCGACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGGGAGGCATCGATGACATGATGATCTCCATGGAGAAGGTGCAGTGTATCTGCAA
CCGAGGGCTATTATGCCTGGCGTGTGGAGCGGCGTTGGGGCAACAAGTGTCCATGACTCGGTGCCGAGATGGCTGAGTCTGAGTATGCGTGCATGCCATG
AAGCTACTCTAAAGGCAGGACAAGTTGTACGGTGTCATGGGTGTCTTTGCCCGCAGACGTGGATAACAGAGTACCACGTCAAGTCACGCAGACTCAAACT
TCATATCGGCTGGTAGATACAAAGCCTTGGTCGATGATGTTGACCCGAAGCCCAAGCAGGGTAGCTGCCCGCGCCACCGGAGTCTGTTGGACCGGAATCT
GCTGGTATAGCGACTCGGCGCTGCAGGGCGGCGCGAGGTTAGGCGACCGGCTGGCGCCTGGCCCGCCGGGGTTCGAATCGTAAGTGGGGGAGGGGATCGG
AAGTGCCCTTCCTCCCGGCGTCTCTGGCAAGGGACTTGCTTCGTCATAGAAGCTGATGTAGTGGCTGCCTGGTGCAACCACTCACGAAGAATTGCACGAA
GGTGCTGGACCTGATGCATCGGTGCTTAGGTCCCAAGGTCATGGTGACCGATGGCCAGCAACGTTGGTAGTGGCCACTGCCGCTGCTGGGCCGAAGACGG
CGGGCGAATTCGCTGTCAGAAGGCTGCCTCGGTTTGGCGAGGACATGGCAGCTAATCTGCGGCTTGGCCCACAGACGAAGGTGTGCGCGCTTACGCATCG
CCATGCCGCAGCTCGATGCTGTTGCTACACGGGGCGCAGTACGTCTACCGACCAGGTAGCCACCAGCACCATGCCATAGCTCAAGGCTGTTGCTACGCTG
GGGGTGGCACGTCTTCCGGCCAGGTAGCGATCAGCCTCAAGCCCAGGATGGGGCAAACCCGAGGGGCAGCTCCATGCTGTTGCTACGCTGGTCGCGGCAC
GTCTGCCGGTCAGGTAGTCAACAGCAAGGTGGTTGGGTGTAGCCCACGAAGGGTGAACCCGAACGTGTTGCCTTTGTGGGCATTCACACTTAGCGCGGTG
CATGCTGCGCTTGTACGGTACGCGTGCACGCGGCACAATTGTCTGTGAGGTAGGCGCGGAGCCGTCGGCCCATGACGCTCACTGTGCGCGGGGCACTTGG
TGTGTGCGAGGTACTCGCAGTGCACGCGGAACTTGCCGTGATCGTGGTACGCTATGTGCACGAGGCACTAATGGCAGTTGTGGTACACAAGGTGCACGGC
GTGCCTTTGGTGTATGGGGTGGTGCCCCTGTACACAATCATGTCCTGGTATGGGCTGGGCGTCATGCTGCCTAGCACGCACACTGACCTGGTGTTGGTCG
CCGCGATGCATGATGCAACCGCTGGTGGTAGAGGTCAAGGCGTCTCACACCATGATGAAGTGCGATTGCGGTACCTTGGTGTCGACGGAAGACACCTCAG
CGTCGGCTCCACGATGGCCGTGACGCGGGGCAGGACATGGGACAAGTCCGCCGCGTTCCTCGGAATGACGAGCGTGTTGTGAGCAGCAGCCGTGGTCCCC
GGGACTATGGCGACGATGAAGCCCAATGCTTCTTGGCTTGGGTCAACGCTTGACCTCTGTGTGGTATAGCAGCACGCGCAAAATCGTCAGTTGTGGTAAT
ATGGCTACAAAAACAACAATAGCCGGGCTGGTCGGCTTTGATGGCCTGCGCCGGGTTGCCCTCGAGCGGTTCGTACCAACTGGGACAGCGGGTGTCTCGC
CTCTCGCGAGCTCTGCCAACCAAGATAACTCCTCCGGAGAACCGCCCTCTGTTCACTCAACCCTGTGCCCTCCACCAAAAGATGGACGACGGCGCACTGA
GCGCTTTTACACCTCGCTGAGAGCAAAGGCTTCTCGACTTAGCAATCAGTGCCCGGACGTACGGGAACACCGACTCGCAGCGGTGGCGAGACTTTTCCTT
CGCGCTTGGTGAGACACGCGCCCAACCCGGGCCGACCTTAATCTCTTGGCGCTGCCAGCCGAGTACCCTACATGCTTATGCCTCTTGAGTACCGGCAGCA
GACATAATCCGGCCCCGTGCAGGGACTTACCGGAACGTGTACACGTGCTTTAGGGCCTAGCAAAATTCTGCTCTGTTGTTTGTTATCTCTGTCGGGCGCC
CTGAAGGGGCGCCTCCACTATTCCTAAGCTCCCATACAAATACCAAGTGAAAGTGGGCGGTTTTGGATCTGGTCCGGATAAGGCATCCGGATAACTCTTC
GAACTCGGCTGAGCCGGATAATGCAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGA
CTTTCTCGTCCTTGGTGTAGACGCACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCA
GCATTTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGGCCACCAGCCGCTGGCAGATTCCTAACTTAGAATATTACATTTAGAGGAAGTCAGAAA
GCATAAAACAAAAATAGCAGTTCTCATCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTTGTTGAAAGTAAACTCGTGGATCTCGAGTATACTTAAT
TCAAGTAAAAGAAACCTACGCTTCCACATACACGTGCGCATTCGTGGAAGTCGTAGTAGTGAGCCAAGGTAGGCCCACTACACCTGGTAGCACTTAGTAG
TCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGGGCCCATGGAAAG