Description :
From Genome Similarity Track
Location :
Scaffold_2749:3- 2792
Sequence
2789 bases(100 bases per row)
ACCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACG
CAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGA
GTGCTTACCGCGGTGAGCGGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGT
TGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGG
CTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCAC
TGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCG
GTGGGTGTTTATTCACCACGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTG
CTTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTTATGAGTACCATCTCAGCGATCTCT
CCAGCCTTGAAGTTGGCCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTCAGTATCTCTGCAACCTCTGGCAACTGTTCCAAGTGGACACCAGATGCCTT
GACGGGTAAACCCGTCTCGCTATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACG
TCGATCGGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCG
TCGCTACGACATCCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGAC
CGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTATGGTCTGGGCGACCGTGTGTGGCACTGTGTTACCCACACAG
GAAGCGTATCCGACGTCTTCCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAG
CTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTGGGCGCGGCCACCATCAAAACATCCTCGGA
GTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGA
CTCACCAATGCTCTGTCGGACTGCGCAGGGCGGCTGGCACCGATGCCTCGCCAGTCGATCCAGGGCTCGACCTCAAGCAAAGCATGCCCAGGATCATATC
ATATGGATCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTC
CCGTCGGCCAGTCGCACTGATACCTTCCCGTTGCCCTTGCTTTCTCTCAAAGCATCAGACAGCTGGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGA
AATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGAAATGATCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCAA
TTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCACACCCATCACGAAGACTTAGTTTTTCCCCAGTAGAGCGCCCCGCC
CCTACTGGTTCCCGGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGC
AGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCGCAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGAGAGCTGGTCCGTTGGAG
CTTGTTCGGCCGGGAGCCGACAAGGAACTCCCAGGCCATGCTGAGGCCGGCGTACGCGCCTGGCGATGGATGTGCTCTTCTTGAAGAGCCACTTGAATCG
CCTCTTCAAGAGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGTCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCGTTGAG
TGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGCTCGCGCCTCCCTTCTTTACACGCGAGGAAGCGCGAACGCTGG
CGGTACTCGTAGTTCGCCGGGAGAAACGCGGATCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGAAGATGCTGCTTCCCGTGTGTACA
CCCAACTCTTAGCACGGCCGCTAAGGTTGGAGAGCGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAACCGCGTCCATCGCGAGC