Description :
From Genome Similarity Track
Location :
Scaffold_2919:3- 2725
Sequence
2722 bases(100 bases per row)
GTTTCCTTTGAACGAACTTGGGCCAACGAGGGGGATATTGATCCCATGGCTATGATTTGGAAAGAGTAAAGTCGGCTTGGAATAATCCCCAGGTGACTAC
CATTCGATTGTGAGACCTGCCCTTTGCCTGTTCTCACAAATCCACGCAATCACCGACATATCGATTGTACGCTCTTGAATAAGTCCTCTACCAGTGGAAA
ACATTCCCGAGATTTCGCTGAGTAGATCCGACCAAATACCCCTGATGTCCGCCTTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAAGGT
TTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAGTTCATTCAGATCCACTGCGTAATCC
GTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTT
GTGCTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCAT
CACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCACTTCGACA
CTACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGTACCAACTCGTGATCCATCCAACCACGCAGGT
GGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCTCCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCAC
CAGCCTTTTTGGATCTTGTCCTTTTAGTAGATCCCAACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCATAAGTGGATCTG
GCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACA
GATCCTCATCCACTTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCGTCCATCTTAGCTCG
AGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTTGAACACTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGT
CCTAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGGTCGTCCCACTAGCAGGTTGTAATTCA
GATCCAACACGCGCAGGAGCGCGAGTATCTCTTTTCTCACCGCTCCGTAGTTCAGTTCATTTCGGCTTTAGTGTCCGGCTGACGAAGGTGACTGGATAGC
AGATCCCCTCATGTTCTTGAACCAGAGCTGCTAAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGAT
AGGCGTGGTCACGATTCTGTTCCTCAGTTTCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATC
CAGCCTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATTCCTTCGTGGATCCGGCA
TCTCCTGGGCCAGAGCTTGTGGATTTTCATCTGGACAGCTGGAGTGGTCATCACGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGG
GCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACA
GGTCCTTAGGATTCGCCTCTAATCCCTCCTTGGAAACTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTAACCACACTGATAGAGAG
ATTCCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCG
TCCTAACACAGACGGGGTCCCAGAATCCCCTGGCTCCCCCGCTTCAAATGGATCCACTTCCGTATGGCCTTCCCCGGATCCACCCGCTTCGGGCTCCGGT
ATTCGGGTGAACCCATAGAGGGCGTTATCGATCACGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAA
ACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACAGCCCAGAAACCACTGGCCATGGCTAGAGAACAGTACCAGAGTACCTTATC
CAGATCTTCCAACAGCTCATTGATCAGAGGCATCGGATACACCATCAATTAAGTCAGGCTGTTAACCAGCCGGTAATCGATGCACAGACGTATATCCACC
CCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTT
CTCTCGGAACTGAGGTGCCACC