Description :
From Genome Similarity Track
Location :
Scaffold_2636:3- 2644
Transcript NameFunction/comments
Phypl_g15273hypothetical protein PHYSODRAFT_340298

Sequence
2641 bases(100 bases per row)
CATAAATCGGGGATCCTGGTCATGTCGAAGCAGCGAACTCGCCCCGAATCTCTGAAAGAGACTTCACATGCCTCTGCCACGCCCTGAGCGGTCGTCGAAC
TCATCAGCTTGCACATGATAAATCCGGAAAAGGAGTCCTGAAACAGAAGCAGGAAGGTATTTCCACGGTCCGACTTCGGCATGTGAGTTACAAAGTCCAT
GGACACCAGTTCGAAAGGTCTTCTCGGTTCGATATTTCCGGGCGACGGACCGGGGTTCGGCGGTCGTCCTTTACCACTCGCACAATCCACACATTCTTTC
ACAAATCGCTCCACGTCGGCATACATCCCAGGCCAATAAAACTCAGAACACAATTTTTCATGCGTTCGAGTGATGCCCTGGTGTCCACCTTGGTAGTCTT
CGTGAGCGTAATGCAACATGTCAGATCGAAGTGATTCCGGAACGACGAGCCTCGGTTCATCCACAACGTCTCGCGGGCGGTCTCGGGCTGAGCGCGCCAA
TCGGTACAGGATGTCTCGAGAGTCCAACGCGAACAAGCCAGAAATCTTGGCGATTTTCCAGAGGCGGCGAGGTGAGAATCGATCGACGTCCCCCTTCAGA
AAAGCCTTGATCTCCAAAAGAtactcgtcttcatcctgaTGCACCTTAATGCGCTGCCAACGTTCTGCTTGAAACTCCAATGGGCTCATCGGTTGGTCGT
CCGGACGAGGCTCTTGCTGAGTTCCCGACCGAGTAATAACGGCCATGACCTTAGCGGGATGAGATAACGGCGCAGATCCGGCATCCGGAAGCGCATCTCT
TTTCGGGTCATCATTCGGACTCACGACTGCAGCTGGAACCTCGGACTCATCAGCTTCTCGGGGGTTTTGGACACCATTTTCAGGTGAACAAGCTCATCCT
CTTCTAGGACGTCCCATGACTTTTCGAGAAGAAGAGTCTTCGAAGTCAGATAGTCAGCGGCCTGATTGTATTCTCCTTTCAAGTGCACCGGCCGGAGAGA
CGTGAACTCTGCTTTCGAAACCTCCGCATTTGCTAGATGTTTCTGCAAGTGAGGTTGATTACAGTTAATCAGTCCCTGTACCTGCTGTATGACGATCCGA
GAATCACCGACGACTACCAAGTCTCTGATTTTCCGCTCAACAGCCATCGACAGTCCATTTAGAAGTCCGGAATACTCGGCGTCGTTCACCGTGACATCAT
TCAGAATGAACCCTTTGTTTCCAGAACCGTCCATCCAGGTAGAGTCCACAGGACACACCCACAACTTCCAAGTCGGGTCGACGTCTTGGCGGCTCCATCG
AAACTCAGGACGACACCTTCATAGTCAGCCTCCAACATCTCTACGCTCATCACTGGTGGTTTTCGGACTTGTCCTTTCGCGGGAATCAATGATTCAGCAA
TCTCATCTAGGTGTTCGCGTGGGGTAATACCCGCGCCCATGATGGCTGCCAATCCGTCCTCATCACGCTGGACTTTCCGAATCTCCATATCCCAGTGAGA
CAGAGTAACTCCCCACGGAACACATCGGCCATCCGCAGACTTCGACTTGATTACCCATTTTAGAACGGAGTATCTCGTATAGAAGNATCCGCAGACTTCG
ACTTGATTACCCATTTCAGAACGGAGTATCTCGTATAGACGATCAGAGGACAGCGGTCGAGAATTGTCTGAAAGACTTGCAACACCCGCATGATCGCGAT
GACTTCCTTTTCAGCGATATGATATCTCAGCTCGGCGTCATTCAGAACGCGACCTGTATACCTCACTGGTTGGATGACTCCGTCATATTCCTGACCTAGG
ACTGCACAAGCGGCCCACTGGTTCGCATGTGGAATAATGATGAACGGCTTCATCCGGTCCGGATGACGTAACAGCGGCGTCGAAACGATCTTCCTCTTGA
GTATCTCAAATGCATCCTTGGCCTTAGTCAGATCACGTCCTGCGCGCACCTGTCCGTCCAAAAGCTCATATAGTACCGCAGCCACCACCGGAAAATCTTC
AATGAACTGATGATAGTGGTTCAGACTTCCGAGGAAAGACTGGACACCTTTCAGAGTCTTCGGAAACGGCAGATCTCGAACTCCTTTCGCGATCTTCGGA
ACGGCTCGAATCCCCTCAGCTCTAATCTCATGTGAGAGGTAAAGGATCGAGCGCTTTCCGAATTCGCTCTTCGGAAGACTCACAGAGATGTTCAAATATC
TGAGTCGGAGCAGCAGTGCGTTCAGGTCATCGCACAATTGGTCCCAGGTCTCTGCTCCATGAGCGATGTCATCGATGTAGGAACTACGTCCCAAGACCGG
ATCCATCTGAGATGGAGTAGAGATGTTCCATTTGAAGACAGTCATAAGGTCAGTCAGAGGTTGAACTTTCTGAGTAGCGATCTCGCGTACAGACTTCTCG
CTTTCGGACGGGTCCAGACCCAAGAAATCTAGAACATTTTGGTCCACCTTCGCTTCCTCGTTGGGTGGAAGCCTCACAAAACCCCACAGGCAGTTGTTGA
TAACAGTCTGGTAGACGAGTGGTGCGTTCTTGAGTCCAAACGGCATGCGAACCCACTGAAAATGTCCGAACGGACATACAAACGCAGAAATCAACTTTGT
TCGTTTTGACATTCGAACTGCCCAGAATCCACTGGCCATGT