Description :
From Genome Similarity Track
Location :
Scaffold_648:3- 2640
Transcript NameFunction/comments
g7076.t1hypothetical protein

Sequence
2637 bases(100 bases per row)
ACGCACACCCTACTCCTACATATGTATCTCCTACTATGCACCCACACGCATGTCCACGCCGCTTGAGCACTTGGACACGCTCCCACACGCTTGTTCTCAC
GCGCACGCAACCTGCGCGTCTCATCATGAGCACTTGACGCCGCCACAAATCCCCCCGCACACGCGTAGAGGCACGCGCACGCACACACGCCTTGCACCCA
CACCTGGTGCACACATGCACACGCAGCACCCTCTAACACTCTCCCTTGATGCGCTGTGCTTGGCGTCTTAGGCGTCCATGCCGAGTCCGACGAGAAACTG
GCGGTGCTTGGGTCGTGCCAGTGCCTTGGTAAACCCGTCTGCGATCATCTCGTCTGTCGGCTTGTACTCGAGCACGATGACCTTGTCTTCCACCTTCTCG
CGCAAGAAGTGATACTTCAAGTCGATGTGCTTGGTACGTGAGTGGTACGCTGGGTTCTTGGCCAGCGCAATGCAACCTTGGTTGTCCTGAAAAATGGTAG
TCGCACCCACACACTCACACCCCACGTCCAGTAGTAGCTGACGCAGCCACACTGCCTCTTGAGTGGCGTTGTACAGTGCCATGTACTCTGCCTCCGTGCT
CGAGGTTGCCACTGTCGGTTGCCGCTTCGACTTCCACGAAATTGCACTCCCGTTCAGGAAGAACACGTAGCCAGTAGTCGAGCGCCGGGTGTCCAAATCA
CCTGCCCAGTTCGCATCCGCGTAGCCGATCAGCTCTCCCTTAGTCCCGCCGTTGAACACGAGTCCCAGGTCCTGAGTGGTCTTCAAGTACTTCAAAATCC
GCTTCGCAGCCACCCAGTGAGACTTGTTGTACCGCTCGCAAAACTTGGCCACTTCACCCACAGCTTGAGCAATGTCCGGGCGCGTACAAGTTGCCAGGTA
CATCAAAGCCCCCACCAACTCGCGATACGGGTACCTGGGCACGAAATCTTCGTCTTCTGACGGCTTCACCAGCTTCGAGTTGCTGTCCGCTGGTGTGTGC
ACTGCCTTGCACTTTTCCACGCCGAACTCCTCCGCAAGTCGTTGAATATACGCTCGCTGATTCATGACGATGGTCTTGTCGTCGCGGTTGCGGTGGATCT
CGATGCCGAGACAGTACTTCAGCTCACCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTTGATCTCACCGATCTCCGCTTTCGTCCTGCTGAA
GATCATGAGGTCGTCCACGTAGACGATAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACACACGGATCCGCCGCTGACCGATGGAAACCTTGG
CCCTCCAGGTGCTTGTTCAGCTTGCTGTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTTGCATCAACAGGCACTTCTTGGTTGGGTTGACTT
GGTCTTCAAATCCGTCCGGCTGGTCCATATAGAGCTCCTCTTCAACGTCGCCGTTGAGAAACGCGGTGTCCACATCCACATTTTCAGCCTCCATGTCTTC
CTCTGCTGCAATCGCCACCGCCGTGTTGATGGACTCCTTGTGTGCTACAGGAGCGAAAGTCTCCGTGTAGTCGAGCCCTGGACGTTGCGTGAAGCCCTTC
GCGACGAGGCGAGCCTTGAACTTGATGATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACTTGCACCCAATCGCCTTCTTGTCTGACGGCATGT
CCACCAACTTCCAGGTGCGGTGATCCTCAAGCGACTTCATTTCGCTTTCCATGGCGCGCAGCCATTCGTCCTTGTACTTGCTCCGCATGACTTCATCGTA
CGACACCGCGCGCTCACCGTTGTCGTCTTCGGTGAGGAAGCAGTAGAGGGAATCGAACCCAGCCTCGTAGTCGTCCAGGTTGAACTCACCCCTTCGAGTC
CCGGGAAATTCGTCTTGGTAGCGCACGACTCCACGCCTTTTGCGTGCCGGACGCACCATCCACTCCTCTTCGCCGTCTCTTCCTGGCGTGCTAGAGCCAC
GCGTTGGCACAGATCCGGTCGGTCCGCTGTGCTCCTCGGGTTCGTGGAGTGGGCGTGTCGGGGGCGTGCTGAAACCGTCGCCAACACTGGGTTCTTCGGT
GCGCTCCTCTTCTTCATCGTTGTCGATGATGTCGATCACCTCCTGGTTGCGCGTCTTCACCATTGTGACCGGTGGCGCTTCAGCAAACGCCACACTCCTT
GAAATCACGATCGATCCGTCGCTGGGGTCCAGGAGTCGATATGCTTTGTGTTGCTTGGCATAGCCGAGAAACACGCACTTGATCCCCGAGTTGTCCAGCT
TTTTGCGTTTCTGCTTGGTCACATGGGCGTAGCACTCGGTCCCAAAAACGCGCATGTGCTCCAGACGTGGCGCCCTCTTGAAAACCAGCTGGAATGGGCT
TGCGTGTGGGCTTGACGTGTTAGGCAACACGTTCCGAATGTCTGCAGCTGTCATGATGGCCTCGCACCAGTACGACTTGTCCATCCCGCTCTCCCCCAGC
ATGCAGCGTGTCATTTCGACCAGCGTACGGTTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCT
CGTCGCACAGAGCCACCATCCCCGCGTTGCAGTATTC