Description :
From Genome Similarity Track
Location :
Scaffold_1040:3- 2551
Sequence
2548 bases(100 bases per row)
TTGGTGGGTCGCCAGAAAGGCTGGGTCGCATCTACCTGGAAGCGCCAACTCTTCAGCACGGGAGATGGCCGGAAAAGCGGCAAATGTCTTACATCAATGG
CAATGAGGTCCTCAACATCAGCGCCCAGACTCAGCCAGCATCGGCCGCCAAGATTGAAGGACGAGGACCGTGGCGATTCTGCTTACTGCGAAAGTCTTCC
CCAAGAGCTACGAGAACGTCGTGCTCAATTCTGGAGATGAGCAACGCAGAGCTGCGGTCCTAAGACGTTGTGAAAGTGCTCACAAACGAGCACATCAAGC
GACAAGGTGAGAAGACGGCGACGGTGAAAACTGAAAACGCGGCCAAGGCGTTCAACACCGACCGAGAGTCTCGCCAATGCACGTACTGCGGGAAATTGGG
GCACATGATTGACAAGTGCTGGACCAAGCAGAAGGATGAGGGTCGAGGTGCTCGACGCGGCGGCAACGGCCGTGGACGCGGAGCTAACAACATCCAGTGG
CGAAATGACGGCGACGATGACTACGACTACGATCGAGTAGCGTTCGCGGTTTCCCTGGAATGTGGAGTATCGACGAACAAGAATGTGTCTGGAATGTGGG
CGGTCGACAGTGGTGCCACACACCACATTTGTAACGACAAGTCCAAGTTCGCCAATCTCATCGAGCGCAATGAAGGCGAACTTTCGGTGGCCGACGGGAA
CAAGGCGGCTATCAAGGGTGTGGGGACCATCGTGGAAAGAGTGGTCCTGCCTAACGGCACCGAGCGCGAGATCGAGATCAAGAACGCGCTCTATGTGCCT
AACAGAAGCCAGAATCTGCTTTCAGTACCGCAGATCAACAAGAACGGAAAGTTCCAAGTGGTGTTCGATGGCACTGAGATGCACATCTCACGCAAGGACT
CGAATCAAGTGGTGGCATCGGCGGATCTCGTAGATGGACTCTACTGGCTTCGCACGCCTCTTCGATCAGCAAATGCGGCGACAACTGGAAGGACGGTCGA
CCTGCATGCGCGTATGGGTCACGCTCCAGTCGAGGTGCTTCGCAAGATGGTCGACAACAAGATGACCAAGGACGCGAAAGCACCTTCCAAGCCTAGCGGA
CCAAGTCTGTGTCGCGGCTGCCAGCAAGGCAAGATGGTCCAAAACCCATTCCCTACCAACCGTGACAAGCGTCGCTACGACACTTTCGAGTTGCTTCACT
TCGACATTTGCGGACCCATGGAGAAGTCCTCGCTTGGTGGCAGCAAATATTTGCTACTGATCGTGGACGAAGCCAGCGGATGCATGAAGGGCTTCTGCCT
GCGTGCCAAATCAGAAAGCGAAGACTGCATCAAGACGTACATCACGAAGGTGCAGAAGCAGTTTGGCAAGAAGGTCAAGTTCGTGCGACACGACGGAGCT
CGGGAGTTTGCGACTAACTCGCTTAAAGATTTCTACGAAGACGAGGGCATCGAGCAACAACCACGGTTCCGTACGCGCACCAGACTAACGGCACGGCAGA
GCGGGCCATCCGCACCATCGTCACGATCGGCCGCAGCATGCTGCATCATGCCAAGCTAGACAAGTGTTTCTGGGGTGAAGCGGCGATGACGGCCATCTAC
GTGAAGAACCGCCTGCCGTCACCAAAGATCGAGTGCAAGACTCCGTTCGAAATTGTGTACAAGTCCGCGCCGAGTGTGAAACACATGCGCGTCTTCGGCT
GTCGAGCTTTCATCTTAACTCCAAAGGAGAAACGGCTCAAGTGGGATCCAAAGGCTCGCGCCGGATTGTTCCTGGGCTACGAAGAAGTATCCAAGGCGTA
TCGACTTTATGACATCGAGGCGGGGCAGGTGGTTATCAGTCGCGATGTCAACTTCGATGAATCGACCTTTGGACTTTCAGAGCCAATTTCCGATGAAGAC
GTCGACGACCTGGACTTCGAATCTCTCGACATCGACAATGACGGTTCGCGTCAGACGGAGCACAGGCAGGCGGGAAAGCGCAAGAGCCGCCCGAGTGAAG
ATGAATCTGCCACAAGACCGCGAGCTACGCGTCATCGACCCGGACTGGAAGAAGCAAGTGCGCCGACCAATTCGTCTTCACGTCGAGCAGACGTAAACGA
AGAAGAAAAAGCTGGAGATCAAGATGAAGAATCGACTCCCCCCGTGTTTTGGCGTGCAAGTGCCAACGCAGTCGAAGCTGCGGTGGACTTATCGGAGCCA
GCGACTTTCCAAGAGGCGGTGAACGGCCCCGACCAAGTGCACTGGCGCAAAGCAATTCGTGCTGAGCTCAAGTCGATGCGACTTCGAGGAGTGTTCCGTG
CTGCTAAGTTGCCGAACGGACAACGCGCTATTGGTACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGATCGATCGAGAAGTACAAGGCACGCCT
CGTGGCCAAGGGCTTCAAGCAAAAGTACGGCATCGACTACACTGAGACGTTCTCGCCGGTTGTCAAGTACGTGACGTTGCGCATGGTGATCGCTTTGGCC
AAGTACTTTGGCTGGCCGCTAGACCAACTAGACGTGGTGACGGCATTC