Description :
From Genome Similarity Track
Location :
Scaffold_41:3- 2529
Sequence
2526 bases(100 bases per row)
CAAAAAGATCCACGAAGACGGCTGCTATCGCTCGCGCCACCACACGAATATATCGATACCCCTTTTTCATACTGGGACTCAAAAGGTTGTTCACATCCGC
AGCGGTAGCGAGTCGTTGCAGATAAAACGACTATTAAGACGGCATGAGTCGAACACTGGGATTCGCGTAGTGTCTAAACATAGATATGAGCTGAGCGTGG
CCACGTTGCGTTCTGTATCTCGGAACGCGTCATATCGGTGAAAGGGTAACATCAGAACGGACACAATACATTACGAATGCCGACGCGATCTGAACAGAGC
CCCAATATCCACATCACATCCAAATCGCGAAGACTGGCTGATGAAACATCATGAGCTATCTGACGGTTTGGCTTTTGTCAAAGCGCTCGCTTTTTTTGCA
AAACGACATCGCTAAGAAACAACTAGATAATGTCCAATGAGTCTCAAGCTAATTATAACATCTTTATCGGCGGTTGCCATTGTTGTAGATTATGCATCTT
TCGTACATAACGTGTCGGCTTGAACATTCTTAAGCATGTTTGTCGGTCCTTCAACGTTACCTACGTATGATAATGACGCCGAGTTGCTTCTGACTCTGAG
TGGACCGATTCTCGTTCACTTTGTTTTATCAAAACTGTCTAATAGAATCGAAACCAAGAGTGGAAAATAAATGCGAGATACAAGACCGATTATTGATGGC
TATTCGGGTCAGACTTCGTCAACAGACCAATTGCCGGCCTTTGGGAGCATCACATGGTCTACGTCTAAATACCGTGTCGTAGTTTAAGTCATGGCAACGC
GGAGTTATGTTCTTGAAGCAAAGAGGCAAACTTGATCCGAGGTTGCCTACTACATGATTGCCCATTTTTTTCCCGACATCGTGATAGAAATCTGTGAGGT
CTCTTGTTGGAAATTTGCTCATTATTTTGTGCTAGTTGTTGCGCAAGCTCGAGCTCTGGATGTTTCGATCAATCATATATGTGCTACTCACAGCTTTTCG
ATCGCCTGTGCGTCGCCAAATGGTTTTCACGATTCCATAATTTGATCAACCTTTTGTCATATTTCCGGGTGCGCCGTAGAAGCCTTAATCGCTGACGTAC
AGATCTAATTAAATGAATACTTAGGACATGTCCGACAGTGTTTTGATACAGGTTTCTGGCTGACTTTACGCCTGTTGTCCCGTTTTGCACATTCAGTCGG
TGCCGAAGTACATGCGCTTCGATCGTCCTATCCAAACGATGTCTCTGCGTCCGAAATTTTCCCAGAACGGGTGACAACAATCTACGTCAAACAACCTGAA
CTTATTACTGCAAGCTCTTAAACACAATAATCATGTTAAGCTTGCTCAGGTAATGGACCACGCTGACTGCGAGGATGGAAACATCGACGCAGGACTGACA
TGTGTAGCTGTCATTACGCAACGGCGTTGGTAGACCTTCCTCGCAATAGTACACAGTACTTTAAACACGACTGCCGCTTATGGGTAACACTTGCACAATA
TGTGATGGCGAGCCACCCAGCCATTTCCATCTTCTACATGGTACATAATAACAAGACGATCAATATCTGCTTCAAACGACCCCATTTCAGAATGCCTGAC
ATTTGTTGCATATCATATTCGGTCTACATTCTGCGTTAATGAAGTCCGGAATAGCTCAAGTCCTGCATTAAGATAAGCTAGGCCGAAGTTTGCAACACCT
AGGGAACTATCACAAACAATTCCTTTTTCATCACTTTACAAGGTATTCGCAAATTGTAGAAATACCTAGATTTATAAGATGAGACAAAGTCACTCTAAGC
TTTACGCGTTTACGCAATCGCCCTGTTATCATTCCATCGTAAGCTCTCCTAATGACGCGGTTGGTTTGCTTGGACTGTTGGACGGTATCAAAATGGAGTG
CTTCTTATACCTTTCCCGTCATGTGTTATACTTCAGGTATCACATAGGTAGAGCGTAAACATTCTGAACGTTGGTACAATTTAGCATGGACATGATATAT
ATGACCACTTCCGATTCAGGTACGTCACTTGCTTCCGTCCCAAACATAGCACCCATGCGTACCCATCATCACCTACTACAGACCATTGCTTCACGCTGAC
CTCCAAAGCCGTCCAGTATGGGTCATATGCCACTCCTGAGTCGAGCTGCGCACGGTTACCATATAACTCGAGACGAGCTCATCTTCCCGATAAGCTTGTA
CCTTCTGCAAAAGAGAGCGTTGCGACGAAAGAGTCGTTGCACCGTGACTTCCTGCTGCTGTAGAACAATCTTGATGTGTATTGAAGGTGTCGTCCGGTTG
GTCACACGCAGCAGGACATTTACCGTCCGTATCGAGATCACCATCGAATGAGAGCACCGGAGTGTCGAGCTGGTACTGGTATAATAGCTCACTCAGTGGA
AATGCATCCATCCACTCGTTGCCATCCTGCAACGCTGACGAATCCAGAGACGTTCGAAGAGCTGGTCTAGTGTACAGCATCTCCATCGTTGAGGCAAAGC
CGCCGTATATGGCGTGAAATGCTCGT