Description :
From Genome Similarity Track
Location :
Scaffold_2606:3- 2527
Transcript NameFunction/comments
Phypl_g15249reverse transcriptase

Sequence
2524 bases(100 bases per row)
GTCCAGCTGAAGTCTCGACGCTACCGAGAGTGGCAGAACCTGGCTTACGGCGCCACTTGCAGCGCCGATAAAGACGGGACGAATGCCGAACCTGAGCTAG
AAGGACCGATGACCGAGCGCCCGGTATACAAGATCCCGCAAAGGATCATGCGCCGTGGCGAGGAGAGGCTGGCGAAGCGAGGCGAAGGCGCACGGACAGC
GACTCCAGCGTTGGCAGCGATGACAGCGGCTCCACGGGATAAGGAGATGACTGCACAGTCAACGCACACATTCAAGACCGAAGAGCCAGTCAGCCAGCCG
CGGAAAGACGGGAAAGTGGTACCGCCAGGAGACTTCGAAGGATCTCAGCTGGAAGACGCCCCAAATTTGGAAAGATCTCAGCCGGGAGCTGAACGGTCGC
CGCCGGAAGATTCGTCGTCCGTAACCGTCGAAAGATCGCAACCGCCACCTGGAGGATCGCCTCCGGGGAATACGGAAGGATCGCGTCCCCTGAACCAGGA
GCCGACGAACGAAActgacgcggacgacgcaGGACTCATCCACGAAGGATCGGACCTCTTCGCagaagaactggaagcggAGATGGCGGTGTTGCCAGAG
ATCTCGGTTACGGCAGAAGTGCGAATCGGGGATCTGAAGGTGGGAAGGCCGACCGGGGATACACCCGAGGAAGCCacacagcaagaagagcgcctACGAC
AGGTTATCCGGAGGCGACGAAAATGGCTTATCGGGAAGGGCAACGCTTTGCCGCCCGCGGCCGTGGGAGTCGTCTGCGATATAGATGTGGGCGACGCGAA
GCCCGTAGCGCAACGCGTCCGCAAGATCCCGCCCCGATTCAAAGAAAAGGTGTCCAACTTGCTCAAGGGCTTGCTCAGTGCTGGCATGATCAGACTGTTC
ACGTCGCCGATTGTAGTGATCGTATAGAAGAACGGGGTCGACATACGACTCTGCATCGATTACCGACTGGTGAACGGACTGACGCAGCTGATGGTTTACC
CGATGCCGCTCGTGAACGACTTGTTGGAGGATTTGGACAAGTACCTGTGGTACTGCTCTCTCGACATGGCCAGCGGATTCTGGGTCGTCCCCACGACGGC
TCGAGCCCAGCTCATCTCCGCGTTCATTACCCCGTTTGGCCTCTTTGAGTGGCTGCGCATGCTATTTGGTTTGTGCAATGCGCCACAGATCTATCAAAGG
CTGATCGACAACGCGCTCTACGGATTCATGAGTCTGTCGACCGACCGCGATACTCGGAACGTCTTCGACGAGGGAGAGCCGGAACCCCCAGGGAACCACT
CCGTCCTAGGTCGGAGATCGTACATCGATGACATCCTAATCGACGGTATGTCGTAGGACGATTTGTGCACGAAGgtggagcggctgctggatgtCTGTGA
ACAATGGCATCTGCCCATAAGTGTGGAGAAGAGTGAGTGGGGTATGTCTCGAGTCGACTACCTGGGCCGCAAGGNAGGTCTCTGAAGCCGGAATTGaagc
gaagccgaagaaCCTGGAATCGCTCGCGACATTGGAGTTCCCGCACACGCCCAAGGGTCTGCAGTCGTTCCTAGGTAGCCTGAACTACTACCGCCGGTTC
ATCGCAGACTTTGCGATCTACACGACGGCACTGTACCCCTCACAGAGGCCGACTTCGGAGCGTACGCCACCCGACCGGAAGTTCACAGCCAGGAGAAGTG
GATACACGCGTTACGCGCAttcgagacgctgaaggccaagatcgccAAGACACCGATGCTGAAGCACTACGATCCAGACCGGGAACCGGTGGTCATCGTG
TACGCCAGTGAATGGGCGATATCCGCGGTACTCGCACAGGATCATGGCGGTGTGTGCATGCCAGTGAAGTTCACCAGCCGCACACTCAAGCCCAACGAGC
TGAACTATGACGTCGCCGAAAAGGAGATCCTGGCTCTGTTGCGCGTCTTGAACGATTGCTTCACGATGTTGGCCGGGAGGGCGATCCGTGTCCTGACGCA
GCATACGACGTTGGCGTGGCTTTTCCGATCTAAAGGACGGCAAGACCGACTGTCGCAGTGGGCCGCGATACTCTCACCGTGGAGACTCGAGATATTCTGG
TCCATgaaaggagaagaagagatCCTGGGAACGCTTGTCGCGAGTATCACGCCTAGAGCGTTCGtcgacacggcgctggaagagatCGCTCCACGTAGAC
GTCCGTCGCGAATCACTGTCATCCCGATCCCGGCGGTTTCAtcggacgaagagctgcatgtTGTCAGCTTCGACAGAtcggccaaggccaagcgcgaagG
CGGATCATTCAGCGCGATTGTCTGGAAACTGCCGGGTTGGGAGATAATCCAAGCCGCATCGGGCTACGCGTCCGACCTCACGGTCAACGAGGCGAAATAC
CGAGGATTGCTTCTGGgatgctcgctgctggaagggCTAGAGGTCGCACGACTGGTCGTCTGTGGAGACTCGAACCTCGTCATCCGGCAGATGCGTGAGG
AGATGGACTGTAAGTCACCGGGCC