Description :
From Genome Similarity Track
Location :
Scaffold_3532:3- 2519
Sequence
2516 bases(100 bases per row)
CTTGTCGCTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGG
CTGCTCGGTGTGTGCTTCTCGCGCCACACCGCATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTG
GGGATACCCCTGGGTTATGCCCGAGAACTGTCCCACATGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAG
TTATGGGAACTCCATGAAGATCAGCAGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAA
GGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAATCCCCGGACTAC
TTATGAAGCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCAT
AACCCCTCCACTTCACGAGGAGCTGTCGCTTCCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAG
GGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGG
TTGACCGCCTCCGTCAACGTCTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGC
TCGTCTTGCGGGTCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTT
CCCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGT
ACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCC
GACGACCTCGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAA
GACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAA
GCATAGCTTCAGTTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAAATCTTCCTTGT
TTGTCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTGTCCATAAGGGATTCCACCTGTT
TCCGCAGCGAAACTGGTCTCACATCCGAGACCATGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGT
GAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAGCCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGC
TACGTCGACTACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCTTCGAGCACTCGATTGACGCGCTCTGTGTGGCTGTCTGTCTGCGGATGGT
CCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGAAAACAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGGTCTCGGTCCAAGACTATCGTCTCCGG
GAGACCGTGATAGCGGAACACGCCATCGACGAAAAACCTTGCGGTTTGTTCGCCCGTAACAGTGACGGGAACCGGAGCAAGATGTACCATCTGGCTCAGC
CGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGACGGTACGA
GCAGGCTCTGTAGCGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGGCTTCACATATCGGGCGACCCACTTGTACATGTGGGT
CCACCAGAAGGACTGAGAAACCGACAGAAAGGTCTTCTCGCGACCCAAGTGGCCGCAGGATGGCGCGTCGTGTGCCTCCCCGAGGATGTCGAACTTCAGA
TCCTCGTCGTTGGGTACGCCCACCCGCGGAGGTTCATTGGGCTCCACCCGGTAATAGAGGAGGCCATCCTTCAACTCATAACGGTGGAGCCGTGAGCGCT
GTCGCGTCGAGAGCCA