Description :
From Genome Similarity Track
Location :
Scaffold_2678:3- 2494
Transcript NameFunction/comments
Phyta_totarag14730hypothetical protein

Sequence
2491 bases(100 bases per row)
TAGCCGGCCTCAATCtgtctcgatctcctccggTTACGAACACTCATCCGTCGCTATCTCCAGACTGTCCAAGATTTGGTGGCCTGGTATCCAGGGGTAA
ATTCGCGCGCGGCGAATACCAGGGAGAGTCCGTGGATATCTGAACGGCCCTAACCGAATGCGACACTGAAGATCCATGGTGCAACCGTGATCGCAATCAT
CCCCGCGACCATTCCGCTTTCTAGATCGGCCGACTTCCCAACAAGTTCAATCTACCAACAGGTGGTGCTCCCCAACCTTGATCTCGACCGACGAGCTTAC
CCAACCTGGAGATCTGATCTCGATCGGCGAGCATACTCCGCCTGGAGATCGCAAGATCGCCCCTTCGTACGGCGGGATAACCGTTGCGTTCTATACTCAT
TGAATCTGAGCATCTTCTAATCGCCGACATATCCTTCCCTTCTCCATCTAACTTCGTGTCGTCCAATTCTTGATAGCATCGTTCGTCACCACTCCCGACC
TCCTCTTTAGCTCACCGCGCCAGATCGGTACGAGACTTGCCTGTCACGATCGATCGGCCCTAGGTGGGTCGGGTCGATCACTACTCGACTTCGACAAGTG
TGATCCATCGCCCACTTGTCTCGATCGACTGGAGACTTCCGACATGGTTCAGGGTTCATCGCTCCCAAAATCTTAAAATTCGCCTTCGTATGCATACTCA
CACACATCTAACCCTTCCTCCGATCTACGGCCTCCCCGTAAATCCATCATCCAACCCCCTCACCAAGGTGACCATCTCACCCTGGTGGTCCGATCTCACT
CCTCCTCGTGAGATTGCATCGCGCCAAACCGATTTCGACTCGCACGATCTCGAAAGTACTCGTGTAGCAGCGCTCCACAGTTGAGGTCAACTTCGTCTAC
CCAGCTGGGATCGTCGTAGCCCTTCCAGTGCACTAGGAACTCTCGATAGGTTCGACCGTACCGCGTCCGTTTACTAGTCCTCATGCCggtgatcttctcc
acttcgtattCATTCGCACCCAGATCTGGGACCCAGATATCCTCAGGAAGTAAAATCTCGTCGAAATCTAACCGATCGGCTTCGTCTATGGCCAACTCGA
TCCGCGCCCGATCCGGGAATTCCCTAACTGGCTTTAACTTCGACACATGAACAACCGGGAATAGACGATATTCAGTCCCATCGGTCTGAAGTCGCATGGT
GTACTCGTTGATCTTTTCCACAACGCGAATAGGGCCATGCCACAGATGGGCTAACTTCCGGGCGTAGCCTTCCTTCACTCGATCCAGATATAGCCACACT
TGAGATCCAGCTCCTATCGAGTGCGGTCGAACTCCTTCGTTGTGCCGATGGGCTCGATCTGAGATCGCGTCTCGCAGTCGGTCATTAACCTGTTCTCAGG
CTAGCGTGAAGTGTCGTTGGATCCGATATCGCCACCTCCGGGGATCGCGATCTTGTGTTCGGGTGCACCCCAGTGGTACAGTCGCCTCGAGTGTCGATCG
CGGATCCCATCGGTGCACCAGATAGAAGGGTGTATCTCCACGAACCCGATCTTGAGCTGTGTTGATCGCGAACGCCAGTCGCTCCGCATACTCATCCCAA
TCTCGTTGATCTAGATCCTGAACGAACATCTTCAaagctctcgtcgtcgtctgtaCCATTCGTTCTGCTGTGCCGTTCGCCTGATGTCGATAGGCCATCA
TGGCCCGCTGACGCTGTCCGATGATCTTATTAAACGCACGGAAGAAGTCCGACATGAATCCGGGTTCCCGATCGTGTCGAATTGCCTCACTTGCTCCAAA
TCTCCGGAAACACACTCTTCATAGGATTCGGCGATCGTTTGCGCCGTCCGGGACGAGCTAGCTTTGGCGATCACATACCCCGTGAACAGATCGGcccaga
tcagcagctccgtgttgCCTTTGTACGACTTAGGTAGTGACGGTATGTGATCCATCGCGATGATCTGGAACGGGTACGTAGCTTGGATGTTTCCAGGCGA
TTCGCCCCTGATCGTTGGTCGTCCCTTGCCAGTTTCACAGTCAACACATCCACCGACACACTTCTGCACGCTATGATATAGACCCCTCCAGTGGAAGTGA
TCCCGGATCCGCTGATAGGTACGGCCGATCCCTTGATGACCCCCTTCCAGACTGGTGTGGTAATGGTGCAGGATGTCTTGGTGTAGCGTCTCTCGTGCAA
CCAGCCTCATCAATCCGTCGCGATCGGCTTCGGGCGGGCACTAGAACAACAGATCCTGGCTATCCACTTCATAGTCAGCCGCAATATTGCCAAGAGACCT
AGCTTCGTCTTGCATCAGATTCACCACGTATCCTGCCAAGTACTTTTTCATACTCGAGATCCACGCTTCCTCATCATGTGCCTTTCGGATCCGATCGACC
CGCAGCCCACGGACAAACTCTTCTTGCATGACCGTTGGGTTTGATCTAGATCGAGCACCGGACCGAGTAGCCACAGGCGAGATCCGGGCGA