Description :
From Genome Similarity Track
Location :
Scaffold_1947:3- 2476
Sequence
2473 bases(100 bases per row)
TCACCGTGGGCCTCGCCGATCGTCGTGATCATCAAGAAGAACGGCATGGATATCCGACTCTGCATCGATTATCGGCTCGTCAACAGTCTAACCAGGCTGA
TGGTATATCCGATGCCCTTGATCAACGATTTGCTGGATGATCTGGATAAGGAACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGAC
AATGACCGATCGAGCTCGTGCGATCTCGGCCTTTATCACCCACATGGGTCTGTTCGAGTGGAACCGGATGCCGTTCGGCTTGAAGAACGCTCCTCAGATC
TACCAGCGACTTCTGGACGACGCGTTGTATGGGTTCACCAGGATCCCGCGATCGTCAGACTGTGAAGTCACTACGGATTTGATCGAGTCAGGAGAACCAG
AAGATCCGGGGCGTCCATCAGTGCTAGGTCGCAGATCGTACATTGATGACATTCTTGTGACGGCCGGATCATGGGGTGAGCTGTGCGATCGTGAGCTCTT
GGGGGATGCGTAAGGTGGACTATCTGGGACATCGTGTGTCGAACGACGGGCTAGAGGCCAATCCGAAGGATCTCACTGCTCTGACCGATCTGCCGTTCCC
CGGATCGCTCCAATCGATGCAGTCATTATTGGACAGTCTCAACTACTACAGCCGTTTCTTGGAAGATTACGCGATCTACGCGGCGATCCTGTATGAACTG
CGCGAGGTGGACTTCGCCGAGCTGAAGAAGCGCCCTGATCTGCGCCAGATCCTGGACCGTCAAGTGCCGAACTCAGTGGATACGGACCCAGTGAATCCCG
ATCGGACTCCACCAGTTCCTGAAGTCGGGGTCGCCGATGAACGCTGGATCCGTGCTCATCGTGCCTTTTCGACACTGAAGATGAAGATCGCGACGACACC
GATCCTGCGGCACTTCGATCGCGATCGGACTCCGGTCGTGATTGTGTATGCGAGTGACTGGGCGATCTCGGCCGCATTGACGCAGGAGCACGACCAGATC
TATCATCCCGTTACCTTCGCCAGTCGAACGCTGAAGTCAAATGAATTGAACTACAACGTGGTGGAGAAAGAAGTGCTGGCGCTGTTACGGATCCTGGACC
TGAACTATAACATGCTGGTTGGACGATCGATACGGGTCTTGACCCGACACTCGACGTTGGCGTGGCTGTTCCGATCACCCGGCCTTCAAGGCCGATTGGG
TCAGTGGGCTGCACTCCTATCGCCCTGGACACTGGAGATCACGAAGTGCACCAAGGGAGAGGACGAGATATTGGGGGCGATCGCCGCTAGTATTACGCCT
CGATCGGATATGGACGACGCGTTGATCGCGATCGCGCCGAAGAAAGAACCCCGGCGGAAGATTCATGCCCCGATCCCGACTGTGCGTGCGAACGGAGAGC
TGCTGGTGATAAGTTTCGATGGATCTGCCCGCGTCAAGCGAGGCGGAGGCGCATACAGCGCGATCTTGTGGAAGTTACCCGAATGGAGTGTGGTGAAGGC
CCGAGCGGACTATGCTGAAGGGCTGACTGTAAACGAGGCAGAGTATCATGGTCTGTTGTTGGGTTTCGACCTCCTTGACGGCATAGATCAAGGCAGGATA
GTGGTCTGCGGTGATTCCAACCTGGTGATCCGACAAGTACGGGGCGAGATCGACTGCAAAGCACCTAAGCTGACATTGTTGAAGCAAAAGGTGCTGGATC
GACTACGGAACTGGCCAGATCACGAGCTGTTACATGTGAAACGAGACTGGAACGGAAGTGCGGACAGCCTGGCCAGTGCAGCATTCCATCGTGAAGGGGG
CGTCGTCGTCGAGGAGGATGCCGATCATAGGGATCTAGTGACAATGAACCGACTTGATGAGATCCTGGTCGCCCGGTCGGATGAGTCGATCGCCTGACTA
TCGCCGATGACGACCCGATCGGGCACCAGATCATGGCCGAACCCGACCGTCATGCAGGAGGAGTTCGTGCGAGGGTTGCGGATCGATCGGATTCGTCGAG
CACAGGATGAAGAAATGTGGATCGCGGGTATGAAGAAGTATCTGATGGGAGATGTGGCTGATCTGACACAGGATGAGGCTCGATCCTATGGCAACCTCGT
AGCGGACTACGAGATCGACGGTGATAATCTGCTGTTCTATTGCCCACTCTCCAAGCGATCGGAGGCAGATCGAGATGGACTGCTGAGACTGGTCGCACCG
GAGACGCTGCATCAAGACATCCTGCATCAATATCACTCCACTCTGGAAGGTGGACACCAGGGGATCGGGCGTACATACCAGCGGATCCGCGATCACTTTC
ACTGGAGAGGTCTCTTCAGAAGTGTGCAGAAGTACGTCGGCGAATGTGTCGACTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGGAGTCGCCGGGA
AACATCCAGGCGACATACCCGTTCCAGATCATAGCAATGGATCACATACCTTCGCTACCCAAGTCGTACAAGG