Description :
From Genome Similarity Track
Location :
Scaffold_115:3- 2406
Sequence
2403 bases(100 bases per row)
GCGCTTGTGCCATGCGTACATATTCATACCATATAACTATCATGTCTTTATATTGCAGATATTATTACATTAGCATGATAAGGAATACATTACCGATGGC
AGCGCTGAGAGACCTGATCATGAAATATGTGCAACACATTTGCGTAGATCACGGTTTCTCGATGATCCGGCTAACAGCAACGTTTTCAGCAAAAACGTCA
CTTACATGACGACGAGAACAATGACGCCGATACCATCAATACAGCCAGCCTCAAGGCAACCAGCGTCAAGGAATGACGTATAAAAGTCATTTCTAGACGG
TTATTAGCTGGCGGTGGACTCTCACAGGCGTCCTCCTGAATAGAAAAGCAAGCGACACACATAAGTGTTATATGGCATGCGTATGTAAGTCAAACAAATG
CAGTGTGCTCCGCAAGTATAGTATCACATCAACAGAGCCAAAACATGTAGTTTATTAATGGGTATCATTGATCGCTACTCTCTGCACCCTATTCATTACA
TCGGTCTTCGTAGCTCATCGCGTGCCGGCAATCGCCATTACAGCAGATACGAATAAAATCTCGAAGTGGGGAAGGTATACCAAAACTAGCATGATCAGCA
TTAGATTGGGTATAATAGATCAAGAGTAGAAGTCATATTTTTGATTGGCTAAACCAAATCGCCGGTAGAATGACCCACTCGCGACCGGTACGTTTATTCT
TTCCCTATACTTAATCATCTTTTAACTATGCCTAAATATAAACATGTATTATAATATCTGCTCACCACTCATTGCGTACTTCTGCCGTGGCATGGCTTAA
TTGATTATTATAATTACCCTATAAAAACCAATGAACAGTGCATTACTTCTGCATCACACTATTACCAGCTAGAATAATATTGTGAGAATACGATGTATTC
CAAACATAATATTCACGCTTAGTGTTTACTATATGTAAAATATCATGTAACGGAGTCATCCCGTTACAGGTCAGAGGTACGATAAAGTTGGTGGTTTGAG
ACGAATGGACGTTACTTCTTAAGTGTACACAATGCGTTTCGACTATCAAGAGGCCTTTAAATTTTGCTACTTGTTTAATGTATGGGGTGAATGCTCATCA
GCGAAAACTGAAGGCTCATTAGTTGCTCCCTTTAAAAAATAGCTTAGGTGGTAAAGTACTAGCCTTTTCAGCTTTTAACGGTCGAGTCATATTCAAGAGT
CTGCGTTTTTTACTTTACAACGATAATATACAATAATTCTATAAATTATAGGGGAAATAAAAAAATGCCTCATTTTATCACAATAATAAAAAAATGCCCT
AGATAACTAGAAAATAGAAATAATGCCCTAGATAATTGGAAAATAAAATAATGCCCCGGATAATGAGAAAATAAAAAATGCCCCACGTCCTTGTATACTC
AAGTTAAAGTGGTACACATAAACCGTCATGGTGTTTCTATGAAGGACTGAACCTATTATAAATACCAATCACACGCAATATGCTGATACGTCTGACTTGC
TTACCTCTTGAACTCTCCACGTCCAGCGTGCTGTCCTTGGAGTTTAAAACTGTTAACACCACGAACAAATTCCTATAACAGCACTGAAATGTCGCCATCA
GCACTGGTAAAGCCTTCGAATTAGTAAATGAAAGTCAAACAGATAGAATGGATTCATCATAGTCTATTTAACGGTTAAATATGCTAAAGTAACTATGGCG
TACGAGTAGGAAGCGAATTCCTATCCCGCGACTATAACAGCAGAACTGTAGTACCAACAAAAACAACACAAAACAGTAGTAACACCAAGAACACTAACAG
CAGTAGCAAGAGCAGCGGTAAGAAAAGAAGCAGTAGCAGCTGCAAAAACAGCAGATACACCAGCTACACCAGCACCAACAACAGCCACAGCAGCAACGAC
AACAATACTACGATGACATCAGCAGCGCCACCACCACCACCAGCAGTAACAAAAGCAACAAGAGCATCATAAAAACTTACAGCAACAACGATTACAGCGG
CAGCGGTTGCAGCAACAACGACTTGAACAACTGAAACAAAAATAACAATAGTACCAATTATAACATTAGAAAACAATAATAACAATAACAAAACAATATC
AAAAATAATACCATCAATAATATCAGCACCGATTGTCTACGTTTACGGCTGCGGCTGACGATACAAATCCCCTCCCCATAAGATCAACCTAGCGCTTTTG
CACACACCTTAACTATCGGGAGGTGTCGAGCTGGCTTCCATCATGATAGCAGGTATAGGCTTCCAGGGAGCGACGCAGATCTGATTGGAGGAGCGTCTCC
ACTAGTGAGAGCTCTCGAAAGCTATTAGCACCCCGGGGTGTCCAGCAGATTATTAGGATCGTGGCTGTCACAAACTTTACCGCATCCAAAAAAGGTTGGA
AGT