Description :
From Genome Similarity Track
Location :
Scaffold_1129:3- 2376
Sequence
2373 bases(100 bases per row)
CGTGGATTAGCCATGACGAGCAGCACCCCGTATGAGACGACGATGGATCTGGTATAAGCGATGTACGAGAAGGCAAGATCTACCAAGACTTATCTCGGAT
CCACCCTTACCTGGATCCACTTAGACGGATATGGGATATACTATATAAGAGTGGATCGAGTGTGGATCCTATGAAGGAATGGTGGTAGGTGTCATCTGAA
GGTGGATCTAGTAACCACGGTTAACGAGAAGTCAAGATCCACCGCGAGGTGTCCCGGATCCCATACTTCCGAGTTCGGATCCAAGGAGGGAAGATCCCGC
ATAGAAGGACCTGGATCCAGGGTACAGGGATGAGGGATGCAGTGGATCTGGGACTTTCGTGGGACAATGGAGATCACAGACGGTTGCGAGATGATGTTGG
ATGATTGGAGAGCTCAGATCCACGACGAGTGTACACTTACAGTGAAGTGGATCCAAGCGGCCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCCTA
ATGATTACGTCATGGATCCGGTAGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGGAAGAAGGGACATGCAGCCGAGCCGGCTAAGGGATTTAG
CAGGTGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAAATATCAATACAGACTTCTATTTGCACGATAACACGCAAGTGCCTTCCTGCCC
TCAACAACCGGAACTGCATTGGCTGTACGAGCTCGGAGAAGGTTGGGAATTGCGAACCTAGTGTTGGTAGCGATAACTGGATAATACATTGGCCAGATCC
TACAACCTAGTGAGCTTTTCCTATACACGTGCAGATCCAACAGGTTAACCGAATTACTACTTGGTCGGTTACACCCTAGAAGATCTCAACTCTCAAGATC
CCGTCACAGGAGGCGGCAAGTACATCGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAGCCCTACGGCCAGATCCACGATCTAGGCCCCGG
ATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAGA
CACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGG
ATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACATGAT
CTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAA
AGACGGATCTGCGGCCGATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCT
TTACCGCATGTTATCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCAATCCAAATAAAG
CCACACCTGCGATCCCACTTGGATTAGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGG
GATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTAATACTGGAATAGCCGCTTCTAGGGT
GGATTTGGGATCCCACCCATGTAATAAGTAAAATGAGGTATCACCTCGGATCCTGTCTTGGGCGGTAATCATCGCGAAGGGGAGTCGTTCTGCGTACTCA
TCCCAGTCCCTCTGAGTCAGATCCTGGACATACATCTTGAGTGCCCTCGTGATTGTCTGCACCATGCGTTCGGCCGATCCGTTAGCTTGGGGACGATATG
CCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAGGCTCAAAAGAAGTCGGACATAAAGCCTGGCTCCCGATCATGCCGAATCATCTCACTAAC
TCCAAATCTTCGAAACCGCACTCCTCGTATGATTCAGCAATGGTTTGTGCAGTTCTAGACGTACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCA
CCCAGAACAACAATTATGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCC
AGGGTGACTCTCCTTCGATCGTAGGTCTGCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGT