Description :
From Genome Similarity Track
Location :
Scaffold_2534:3- 2329
Transcript NameFunction/comments
Phyta_totarag14593hypothetical protein

Sequence
2326 bases(100 bases per row)
TAAGGTTGGGTGCTATATCGACACGAGTCAGAACCAATAATGTGTTGGAATTGGTGAGAACGTGTATACGACAGAAGGAAGAACTCGGATCAAGGTCACC
CTAGCTGGATCGCTGGTATATTTCTTCGATATCTCGGTGGGCGATCTatctggccaagaagccaTCCTAggcatggacttcatggttCCTGTGGGGATCA
GACTGGATCTGGCTGACGGGTCGATCCGCCAACCTGACGAGGTAGAGATCCGACTCAGCGGGCGCCGACAGCTCTATACTGACAAGGCGAGGATCGTGAG
ACTGGATCAGTATATGCAGATCGAGATCGGAGAGTTGGTGGAGCTCCCGCTGCGCCTGCGAACGTCGGAGCATGATATGTTATGGGTCACACGTGGTGAG
CGCTGGGTACTGACGGTTACTAAAGGACCTGGATGAGTACGACATCTGCAGATCGCCAACGTGGACGAAAAGCAATTGATTTTGCAGGGCGATGAGAGGA
TTGGGATCTGGCTAGCCAGCGACCgtgttcctcgtcttccaggATTCGTGTCGATCGGATCTCGTCACTACATGGAGTGGCAGAATCTCGCTTTCCAGGC
TACCGCCAACGGGCGATCTGGATCCGCTAGTTCACCTGACTTGAAGTGTAGATCGGATGCCCCGCCGTCCGATCGGGTTATCACTGGTGGCGAAGGGCCG
AGATCGATGGAGGTAGAGAGGGTCGAATCAGATCTAGCGAGTCTGGAACCGGAGGACTCCCTCCAAGTCAGCTCGAGCGGGGTCCAAACTGCCATGAAAG
CTTACGATGTAGATCGAGGTGAGAATTGGCCCATTGATGATGTGTCGAAGATGGATCGAACCGGAATGCAGGATGGAGGGGCGACAGTCGAGGAGGTCGG
TGATTACCCCCTGCCAGACAATCAGACTGTCGGAACTTCAATCACTGGGGACAGACTGTCTGGTTTGGGACTTGTAAGATGCTCCGCAACGAGATCTACC
CTCGGAATCCAAGGAGGGACCAAGATCAGCCAGGATTGCGATAGTTGAGGCAGATCCGGCGTCGGATCCAGCGTCGGATCCAGCGTCGGATCCAGCGTCG
AGCGCGTCGACGCAGGAGGTTACTTTACGGATAGCGGAGATCGGGCATAGCCCGACCTCGCAAAGCCACGAGCCACACTGGATCCAGAAAACCGAAGCAG
ATCCGAGGCGGAAGATAAGAAGCCCGATCTACCGTCGACAGTGAtccgaggcgctggagcgtCGAGGGATACGGATCGCAAAAAGAACTTGGAGTCTATC
AATGATGACCGGATCCACTACCATGAGGGTGGTGGGCTGATGGCGGAAGACATCGAAGGCGAGTTGGCAGTGCTTCCGGAAGTTCTCATCTCCACAACAG
ACGAGGTGACGATCGAAGATATCAAGGTAGGCGATCTGGCGTTTAATACCCCGGAGGAGATCGATCTACTACGTAAGATGATCCGGCGGAGAAAACACCT
CTTGATCGGCAAGGCCAATGCACTGCCACAGGCAGCCCGATATGTTATGTGCGACATCGATGCCGGCGACGCAAGGCCGATCGCGCAGCGAGTGCAGAAA
GTGGTACCACGATTCCGAGAGAAGGTGTCAGATCTGATCAAGGGGTTATTATCGGCCAAGATCATCAACCACTCGACGCCCCCATGGGCGTCACCGATCG
TGGTgaccatcaagaagaacggtgTGGATAAATGATTATGTATTGACTAACGGTCTAACTCGGCTGATGGTCTACCCGATGCCACTGATCAACGATCTAC
TCGAGGATCTGGACAAGGTAACGTGGTACTACTCTCTGGATATGGCAAGCGGGTTTTGGGTGGTGTCGATGACCGATCGATCTCGATCGATCTCGGCGTT
CATTATTCCGTTCGGCCTGTTCCAGTGGAATCGAATCTCATTCGGCCTCAAGAACGCACCCCAGATTTACCAACGGCTCCTGGATAATGCACTGTATGGA
TTTATGCGGATCCCGCGATCAAAGCATTCTAAAGGTATCGTGGATCTGTTTGAGGCTGGAGAACTGGGGGATCCGGGGCGCCCATCGGTGTTAGGACGCA
GACCctacatcgacgacatcctAGTGACAGCCGGATCCTGGGATCAGCTATGTAATCGGGTGGAAGATCTCTGGAAGCGTGCGATAAGTGGAACCTGTTG
ATCAGCGTGGCAAAGGGCTTCTGGGGGCTACGCAAGGTGGACTGTCTAGGACATCGGGTGTCAAGTGACGGTCTAGAGGCCAACTCCAAGGATCTGTCGG
CATTAACGGACCTGCCTTTCCCCGGA