Description :
From Genome Similarity Track
Location :
Scaffold_3105:3- 2256
Transcript NameFunction/comments
Phyta_totarag15073hypothetical protein PHYSODRAFT_330603

Sequence
2253 bases(100 bases per row)
TCAAGCGTCCCCAGCATCCAAGATCGGTATGCTTGCGCGACCCGCAGTGTGAGCAGCGCTTGAACGCCGTCCCCAGGTCAGTCGATCTGGCGTGCCAATC
TTGGTGGTGGTTCTGGGTCGCGTAGCCTGTATGGTCGCGGTCTTGATCCGATGTCCCACGACCTTGCGGCTCGCCATGATTTCCAGCTGCTGTTAGGTAC
ACTCTCCGCAGTCCTGCTTCGCCATCCGGTCCGCATGACTCCGCTTCAGACTCACTACTGTCGTCGGTCACGTGGATTGCGCGTACTGCTCGCATGGTGG
CTGGCGGTGTGGTCGCGGCCGGTGCTCTCGTCCGGGGCTTGATAAATCCATAGACGGTCTTAGTCTGACGCGCTCTCCCACGCTGTCGAGAGCAAGCGTC
TCCTCCAAGGTATCGACATCTGGGATTCGCAactggacgaggtggtcgGCAAGATCACGAACATCCAACGTCTCGATGAAGTGGTGGACATGTTCGCGTC
GGGTTTCTGGAGATCCATCCTTCACTTGGAGACGCGCACGGAGGCCAGCTACGTTGAGACTCCAACGGCGACTCGTCCGATCGCTGCCTCGCCTAGTAGT
ACTGTCTCGCGACAGATACACCGCGGCCGGAGTACTGGGTCTGGACACTCAAGAGCAGATCCTTCCAGGTCCTGCGAGTCGTGCGGCTCAACTGTCGGTA
CCAGTTCCGTGCCAGCCCACTGAGAAGATCGCCGAAAACGAGGCACTTCTCATCATCAGGCGCTTGATCTCAGATGAACGCCGATTTCACTTTGCCGATC
CAGGACCGGGGTCGATCTTCCTCGCCCTCCTTTCCAGTGAGCTCCTTCAGTTCGGACATCGCCGACACGCAGAGGCGTGGGACGGCTGTCAATCTTCCAG
CATGTGGAGTCCCTGGTGTAGCTACTGGTGCGCGAGTAATGGTGGCTAGACTGAGGTCGTCGGGATCATATTCCCATGGACAGGAATGGTGATCTGGTGA
TCCAACcgactccatctccacgtcttGATCACCGGTCGGTCTTGTGACACGCGGACGGGGAGTGGACTGTTGTTCTTTCCGGAAGCGTCCCATCGCAGCT
TGGAAGTACGACTCCAGCCTCTCTGGCGAGTGGTGTGTCGGGTGCACTGCTGATATCTTCGTCTCTTATGCGGGTGGTATTGCTTCGCGCTCTGCTCAGT
CTGCCTGATCTCGCAGCATATTGGCACCGGATGGTCCCAGCGTAATTCGCGGCGGATCATCGACGCTGTCCGAGTCTACTTCCTCGGACACCGACTGGTA
GTGCGACGACTTGCCGGTCTAGTCATCCGGATGGGAGGCCGGCTTCGATCTTACGGACTCCTTGGTTGGTTGGTTTATCTTGCCAACCAGGGGCTTCAAC
GTCTCGAAGAGGGTCTTGAGCGCCTGCTCGATCGTACCAAGCTTCAGATCGAAGAGTGTGTCAGCTTCGAACGCACCAGCGATGATTCCAGACTCCTtca
gcagttggagcaaCGTCTTCACCGCATCCAATTTGCTCGACCCAGCGATCGGTTCCGATACAGGACCCTTGAGATTACCAAGGATCATTGGTCGGAGAAC
CAGCACCTCTATGTTCTGGAGCAAGAAGGCATgcaagttcttcttgtagtatgcagcttccagctgctgctcggtcCAGGCTGGCACAGGATCGACGCGA
CATTCAACGTCGGAGTCCGGagcctccatcttcttccgCAAGGGCTTCGATCTCgcagacttcttcttggcgctcgaTCTTGGGCCAAGTGGTTGGTTGG
ATCCCGATTTGTATTGAGATCCGTGGTGGTCCCCGGAGGGACCTGGGGAGGAGGTCGAGGTTTCTCTTCCGAGTTCGTTGCTGGACCCTCCTTTATTCTG
GCGGTAGAGCTCCTCCCAGAACTCTACCGATCCGCGGATTGATCTGGACTTagcagcgtctgcagtgATCCGATCTCCATCGACGCTTGTTTCCCTTGTC
CTTCCTCAGCTTGTGCTACCTCTTGGAGGGACTCACGGTGAAATTCAGAGTCACCCAAAGGtccgggcacgcgcaccattgtggtgtagtgggtctgcga
aaattgctaaTCGCAGATACCTCTCACACACAgcgcccgaaccaccgactaacggagggggaATTTcgatatccgttggatgccaaaacCCTTACTAAac
ttgtgtacccgtcggtagggctgggtcgctcttcgggtgaaCTCGGAGGAAGT