Description :
From Genome Similarity Track
Location :
Scaffold_3124:3- 2229
Transcript NameFunction/comments
Phyta_totarag15087family 3 putative glycosyl hydrolase

Sequence
2226 bases(100 bases per row)
AGGTATCACATAGAACGAAACGCTTGGCTCCGCATCATGCATTCCTGGCCGTTCTGAACCGCTCGGTGACAAGCTGCCAGGGCCGCCGCGGTTGTTAGCC
TGGCTGTACCTTTCACCACTGTCGTTCCTTGCACgtgtcgtctccatcgtcaagCTGTCCGTTgaagatggcagcagcgaaacAACAAACTCGCCAGGTT
CGGCATGTCGTTGGAAGCCACGACCAACGACATGCGGCTCGTAGTAGCTCCAATCTTCAGGCGTAAGCACGAACGCGACATCCTGGCTGGCGCCTGgcgc
gagctcgtcgagcttcttgaacacCTTGAGCAACTTGGTTTCGGGCACAGAAGCTCGCCGGAATTTCTGAGCTACAAATAGTAGCACGACTTCTTTGCCC
GAGCGAGTGCCGCGGTTCGTCACAGTCACGGTAACCTCCAACGCGCCCGTCGTAGCCTGCACCTTGGTGGCGTTAGCTCGTAGCGCCGAGTACTCAAATT
TTGTGTAACTGAGCCCGTGACCAAATTGCCATTGTACGGGGCACTCGTTGTACGGGTGACAACGCGTGCTAACGCGGTGGAAGTACGGCAGTAGATGGCT
GCTGCGAGCTGGGTATGTAATGGGCAACCGCGCGGACGGGTTCACGTCGCCAAAAATCACGTCAGCCAGCGCTTGACCGCCCTGCTCGCAAGGCAGCATG
CTCAAGATaacagcgtcagcatcgTTGTGGGCCCCCTCAAGCAAACGGGGGCGACCAGAGACCAGCACGACAACCACCTTGGTAGAGTTAAGCTTTGTAA
GCTCTTCAAGATACCACAACTGCCCAGCAGGCAGAGCCATACTTCCAAGCAAATCGCCAGTTTTCTCAGCATAGTTTGGTTCACCCAACGCAACCAGAGT
GTACTCACTCTTAGCAGCAAGTTGTAGCCCCCGCTGAAAATCATGGGGGTTCACGTTGCCATCAATATCAACCACCTCCAGTTGCTCAACCTTCGTTTCT
CCACCGGAGGAGGCCGCCTTCGCTTGCACGGCCTCCTTGAATGTGATCCCATTTGGAAAGAccgtcgagttgctggatccTTGCCAGAACACGGACCACC
CACCACATTGAAAACCCTTGTTGTCCGAAACAGGGCCGGTGACAAACACGtttgccgccttcttcaggtcAACGGGCAGAGCGCTATTGTGGTTCTCGAG
TAAAATAACGGACTCCTgggccaacttcaacgcgtCCTCTTGATCAGCAGCACTACCGACATCGTCGTTGGTCATACCATCCTGAGCAAATTCATCGTAA
TAGCTCGAGTCAAGGAGTCCGAGATCTCTTTTAGTTTCCAAAATGCGTCGCACAGATTCGTCAAGGCGAGTCTCTGAAATGAGTCCATCTGTGATCAGCG
ACTCAATCGTGTCACCGAATGCCTGCAAGTCNGTGAAATTCATATCATGCCGCAGCAAAtcaaccagcagctttttGCTGGCAATCACGGGGACGCCATT
CACCGATACGTAGGTCTCCATCGCCGTACGTACGCCAGCGCGGACCGCAGCGAGGAACGACGGCGCGTAGTAGTTGACAAGCTCCCAATCCGTGATGACA
TTATCGGCACGGTCCAGTCCTTCACGGACGTTTGAGTATCCTATAAAGTGCTTCATACAGGCCGCCACCTTGCCCGAACTCTGCAGTCCTTGGATAAGTG
CTGCTCCCATGACAGATGACACCAAAGGATCTTCTCCGAACGTCTCATACACCCGAGACCACTTTGGTTGCACTGCAATGCCCAACACTGGACTAAAGAT
CCACGGTATACCAGCACTCAATGTGTCctttgcagcaacagcacccaTGCGGTACACCAGCTCGGGGTTGAacgaggcagcagcactgaTAGGCTGGCCA
AATAACGTAGCACCCCGCACGTAGGTGGCGCCATGAATGGTGTCCACCCCGTAGAGCATGGGCACTGCAGCCCCCTCTTCCTTGTAGATCTGGTGGATCT
GTCGGATCACCTCTCGCCAGTCGCTGGCACTCCAGCCCGTTCGTCCGCCAGCGGGTCCCTGAGAGAACGGACTGTTGAGTATGGAGCCCACACCCGCACG
AGCGTACCGAACCACCACATCTCGTCTCAGAGCCTTCTTCGGGTCTCTCTCGTCCCCATCCACAATTGAGTATATGTCCATCTGCGTCATTTGCGCCGCC
TTCTGGTGGATCGTCATGTTGGCGAG