Description :
From Genome Similarity Track
Location :
Scaffold_272:3- 2171
Sequence
2168 bases(100 bases per row)
TTGATCATTTACGAGCGGTGCTCGAGTGCATGCGTACGAAAAATTGTATGCGAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGATTCCCTTGATGGGG
TGCTACATTGGGAAGTGAGGCCTTCCAGCGGACCCCGCTAAGATAAGGGCCATAGTTTATTGGCCGGTTCCAAAGAACCAAAAAGATCTACGTAAGTGGC
TTGGCCTTGCCAATTACTTGCATAAGTACAGTGAGAATTATGCAGATTTGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGG
TGACACCGAACATGAGACTTTTCAGGCAGTTAAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCAGCCTTTCAGTGTCGTCTGT
GACGCATTTGACTTTGCCATAGGCAGTGCTTTGTTACAAACAGATGTCGATGGACGCGAACGGGTCATTGCGTTCGAATCTCGACAGCTCAGAGCTGCTG
AAAAGAGCTATCCAGTTCATGACTAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTTCATCTGCTTGGCTCTAAGCCTTTTGTTATCGA
TACAGATCATACTTCTTTGCGCACGGCGACCCAATCGCCTCACCTCTCGCAGAGGATGGCTCGTTGGCTCTCATTCTTTGCCAAATATAACTTCGAAGTG
AAGTATAAGCCAGGAAAGCAAAATGCTTTGGCTGACGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTTTCATCTTCAGTCACTG
ACTTAATCCGTGGGGCTTATGACAAGGATGAACAATGTGTAGATTTGCTACGTGCTCTTGGGAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGC
ACGTTTACGTTCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTGCTATCGCACATATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGAT
GAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATT
GGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGCTGCGGCGCCGCTGGCTAG
TCTGCCTGTACCCTCTGGGTTTTGGGAGTCCATGAGTATGGACTTTGTGTTTGGCCTACCAAAATATTCCGAAAGGCAACTCTGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN