Description :
From Genome Similarity Track
Location :
scaffold_279:3- 2168
Sequence
2165 bases(100 bases per row)
tacagtgcactcgacttggtcgatggatattaccaattgctcatgagagcgagtgttgTTCCGCTGATAGTGGTAAATACCCCAAGCGGCAAGTTCTCCA
ggaatggctggtgatgcctcagcaccagcaacatttaattgtcttgtaacgcaattgttcaggccccaacgggcgtatgcacagacatacttcgacgaaa
tCTTCGTCTACAGTCGTGCTGGACATGGGAGGACAGATATAGGgaaccacatcgtcgatttcagagcggtgctcgagtgcatacgCACTAATATGCTGTG
TGCTGATACAGACTCGTGCATTTTCGGCGCGGAAAAAAATCCTTTTAAGGTGCTTCATCGCGAAGCGTGTGCTTCAAGCGGAGCCCGATAAGGCCAAGat
tattgtggactggccgttTTCAAGGAACCAGAAGTAGTCTTGGCCTAGACAACCACTTGCACTAGAAAAGTTTAAATTATTCTATTCAGAATTGGTGTGG
CCATTGTAGAATCTCCGTgtgaaggatgcggaatgttgttgggacaccgagcatagaaaggcttttgacagggtcaatggcagcctccttcatgcagcaA
TACTGGCgatgccagaccctgatcgtccttttagtgtcgcctgtgacgcttcggatttTGCCATTAGTtgtgcgctgctgcaagcagactcCAAGGGGCG
TGAGAGGGTGATCGAGTTCGAATCTTGTTAGCTTAAGGCCGCGGAGGGAACCTACCCAATCCACAACAAGGAAATAATTTTgatgaaatatgcacttgac
aagtgtatagTGAACCTGCTTGGCATAgtgccgtttgtgatctacacagatcatgcgtaaTTACGAACTGCGAcacagtcgcctcacctctcgccgAGAA
TGGGCAGGTGGATCttattcttcgcagaatatactTTCGTGGTCAAGTATAAGTCTGGAAAGcataatgctttggctgatttattgtcacgcagactagA
TAacaagcttgctcatgtcacgacggtaacgtcgtcagtgacagatTCGATCCGCGGATacgtcacgaattgtggttcctcacgactaGGActtaaaata
ccgcatcctctatgaggccaacgacactccactcagtggtcatctcgatagtgagaagatgtattgctgtgtgagttgccactactggtggcccaagttg
tagaAATTGACGAGCGCAtatgtgcacacgtgtgagaaGTGTCAGAGCGTGAAACCCACTCCGAATTCCGTgtcgctggccagtttacctgTACCCTCTG
GGTGTTGGCAATCTATGCGTATGGACGTTGTATTTAGCCTGTCCGCTGGCAGCAACACGGGTCGTGGTTTAAGCAAGATGGCCCaccttgcggcagtgcc
ggacaccaacgacggtgtcggtacggCGACTTTTGttttgtctttcgacaatatGGACTTCCAgcgtcaattgtctctgacagagacccaagattcctgg
gaagttttggtcgacggtCTTTGAGGTGCCGGGCaacaagttgactatgtcaacagtgggccatccgcagaccgatcgTTAAACTGAGCGCgggaatcgc
gtcgttgatgaCATTCTTTgaagcgtctgcgctgagttGCCGAAGCGTTGGAGCGCCGTGCTGCCACCAGAAGAGTCCGTTTCGAACAATGCAATGTatt
tgtctaccggctacacgccgttcttcgCGAACGGCCTCCATCAACCTCGCGTCAGCCAACCCATGGCtaagggcttggtgggggaggaagagccgaacgg
ctagctgatgtcggcCCTCTTAATGCTCGTCAAGAAGTCACTGACcttctgtctaccagactgagtgtcttacgacacggtcgcgatgcgatggctgaat
gcCAAGACATGCGGATAAAATATGCAatcggaagaagcagaagaaatttcgaaaactttgaggttggATCCTGGTTTTTAAGATGCTAAAAACATTACCA
catacatgcagtctctactgtcttcaagacaaagctccgcccGCGGTTTATTGGGTATTTAAAGGTCgtgaccaagcgaggccatgcgtatacgctgaac
ggTTCGAGAAgtatgcgcacccacccggggatttacgtgggcttgcttaagccgtacaaGGATCC