Description :
From Genome Similarity Track
Location :
Scaffold_773:3- 2154
Transcript NameFunction/comments
g5359.t1hypothetical protein

Sequence
2151 bases(100 bases per row)
CTGCTTCTCGTTGCAGTGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTTCACATGGAGGAATTCGTGCTTCGGCCAGGCTTTCACTTG
ATCCATCGCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCGATTTCACCACGCATCTGTCGGATGATCAGATTGGCATCTCCGCAGATCACA
ACTCGCCCCCTGTTCTGATCGGACAGTAATTTGAAGCCTAGCAGAAGTCCGCGATATTCGGCTTCGTTGACAGTCAGGTCGTCGGCGAATTCGGACGCGG
CAGATGTGATCGACCACTCCGGGAGCTTCCAGACAATTGCACTATACGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAA
CTCTTCATCCAGCTCTACCGTCGGCGGCGCCATCGCGATCGTTCGTTTGGGCTCTTTCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGG
GGTGTAATGCTGGCGGCGATCGCGCCCAGGATTTCGTCCTCTCCTTTCAAGCACTTCCGGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTC
CCAATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCGTCGAATACCTCGACAGCACCTTGATCGATCGGTTGGTCAGGACTGTGTAACACAC
GTCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCTGTAATTCAACTCGTTCGACTTCAGCGTACGACTGGTAAAGATCACAGGCCAATAC
ATGCCATCATGTTCCTGAACCAACGCAGCTGAGATAGCCCACTTGTTGGCGTAGACCACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCG
GGGTGGTCGCAAGCTTGGCCTTCAGTAGGTCGAACGCCGTCCTCGCTCTAGTCCACCGATCGTTGGACTCCGGTGCTCGGTCCTCATGCTTCCCGTGGTG
CATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTAAACGGCGAAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAG
GACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGCGATTCCAGATCTTTCGGATTGGCTTCCAAACCATCGGCCGATACCCGATGACCCA
AGTACTCTACCTTCCGATGTCCCCAGAAACTCTTAACCACGCTGATCGACAGATTCCATCGCTCGCAAGCGTCAAGCAATGCCTCGACCCGTCTCGCAGA
TCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGATCGCCTGCCCAGCACCGAAGGTCCCGGGTTTGCCTCGGGTTTCCATTTCTCGAA
CACGTCGGTTGGTTCCGCGTGGTCTCGATCAGGACTTATCCGGAGGTATCCGTACAGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTC
AACCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAACGCGGAGATCTTCCGTGCACGTTCCGTCATGGAGACCACCCAAAAACCAC
TAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTCCAAGAGATCGTTGATCAGCGGCATGGGATATACCATCAACCTGGTCAGACTATT
CACCAAACGGTAGTCGATGCATAGCCGGATGTCGACTCCATTCTTCTTGATGATGATCACGATCGGGGATGCCCATGGTGAGGTTGATGGCTCAATCATT
TTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCCAGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCGCA
CACCGCACCAATCGCAGCGGGTGGAAGGGCGTTCCCTTTACCGATCAGCAAGTGTCGTCACCGCCAGATGATCTGGCGAAGTCGATCGATCTCCTCAGGT
GTATTCGTTTCCGGATCACCTACTTGAATGTCTTCGATCGTGACTTCGTCGGTAGTGATCGGCACTTCGGGTAGGATAGCCATCTGGCTTTCAACGTCTT
CCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTCTGGAG