Description :
From Genome Similarity Track
Location :
Scaffold_3020:3- 2153
Transcript NameFunction/comments
Phyta_totarag15011hypothetical protein

Sequence
2150 bases(100 bases per row)
CAATATTCTCGGGATTCTCCAGGGAGGAGATCCGTAGATCTTGCAGCGTCGGCCCTGCGGTATACATCAACACGGCGTGGACTTGGAGGTCTGGATGTGG
CCTCGCCGTCGCCCGGCTTGAACCGCTTATCCGGATCTTGCTGTTTCAATATCCCCTAGGTTCCCCAAGGTGGAGAGTCAAGGACATGGAGACGTCAGCT
CTGGTATATTCGTCCGCTTGGCGAAGACTTAAGACCACTGCAGTACGTTCCCCGNGGCCCACGTCATGAAGCTCACCACACCCACGGCACACCAAAAGGC
AGTGATCCGCCGGATGGCCCTGCTTGCCACACTTCTGGCACGGTAGACGCCTCCAGCAGCCCAGATCCGTGTGCTTGCGAGATCTACAATGGGTACAGCG
GTTGCGATCGGGTCCGTCAGCCTGGTACCTGGATCTGTGATCTCGAGGCGATTGATCGGGAGGacgtcgatcttcttggcttcGGTCCGCATGGATCGAG
TCTCCCTCGGCTGCTGGCTGGTTTTCATTGCTTGCCGCGAGGTAGATCCGGTGATAGTCGCCCTCATCAGAGTCGGATCCGTCGTTCGATCCGGGGTCGG
ATCCCGATTCCGGAGCTTGGGCTTGAATCGCACGGACATGTTTGGCGGGGCTGCGGGAGCCGGAGTCGGTGCCTTCTGCCTATACTTGCTGGATCCCAGC
GCCGACTGCTTCTGGCGACTCTTGGCACGCTCAAGTGCGCGAAGGACCTCTTCCCGCTCGTCAGCATCCGGCAGTCGCAACAATATCAGCCGATCTGCCA
GCTCTTGATCTCCCAATGTCTCGAGGAAGTGATCGACATGCTCACGTCGATCCTTCGGTCCAccgtccttgatcttcagTCGTGCTCGCAATCCTGCAAC
GTTAANTCGGAGGCTTGATCACGCAAGAATGCGGACTTAACCTTGCTGATCCACCCTCTTGCCCGATCTTCGTCTTGATCGTTTCCGGTGAACTCCTTCA
GATCCGAGATTGCTGCGATCCGCACACGTTGGATTAGCGCGGATCCAGCTGATCCGGCCGTTGCTATGGCCACTGCGGTACGAGTGAGTGAGTCATCCAG
ATCGTCGGGGTCGTATTCTTAGAGAGCGGGGTGGTTATCCGACCGACTCCATGTCCACATCTTGCGCGCCAACGTTCCTTGTCGTGACTGCGACCGGGGT
CGGTGCCGTGATCTGCTGTTCTTTGATGAATCGGCTCATAGCAGCTTGGAAGTACGATTCCAGTCTGCCTGTTGATCCGTCTGGCGAAGTTACGTTCGTG
ATCTGACTTGGCTGTCGCGGCTGCATCCGATCCGGGGATGTCCCACGAGATCGATATCTCAATAGTTCTTCTCCGGAAGGTCCGAGAGGCATACGTTGCG
GCCCTAGAGATCCATCTGAATCAGGTTCTGATGTGACCGATGCGTAATGTGAAGAGCTAGTCTGGTACTCCGTCGTGCTGATCCGGGGCGAGATCTCTGG
ATCTTCAATCCGTCCATTTCCACCTACCAAGACCACTAGTCTAGCGAAAAGCTCTTGGAAGTAGATTTGACGGTATCTAGATCCAGATCGAACAGTCTGT
CAGCGTCGAAAGCGCCGGCAACTAGACCTCCCTCTTTTAGCATTTGAAGTAGGTTCTTCACCGCAGCCAGCTTGTTGGACGTCTCCGTCGGAGCTGACAC
TGGTCCCTTTAGATTTCCGATCTGCTCTAActtcatgatcttcatcGTTGGATCTTGGAGTAAGAACTTGCGTAGTGCCTCGTGGCGAAACGCAAACTCC
AGATCCTGCTCAATCCAACTCGATGGCGATTCCTCTGATCTTCGCCTTCCGACTCAGGGGCCTTAATTTTCTTCCGCGTAGCCTtcaatttcttcttctt
cgttctAGATGTTGGGACTAGCAGGCTTGTGGTCACTTCTTCCGTCGCGAACACATACGGATCGGGTTTTCCCTTACCGATTTGCGTTGCGGTTCTCGAT
GCGTATCGAGATCCGCTGGGGTCCCCGAAGGGACCTGGGGAGGAGATTGAGGTTTCTCTTCTAGATCTGGTTCCAGATCTCCCTCGTTTCCGTCGACAGA
GTTCCTCCCAGCACTCTGTCGATCCGTGGGTCTTGCTTCATTCAGCGGCG