Description :
From Genome Similarity Track
Location :
Scaffold_2043:3- 2095
Sequence
2092 bases(100 bases per row)
GATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCATCGACCTGACTACGC
CACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCATCACTGTTGGACGACGTGAAGGTCGCGTTCGCGCACGACGAG
GACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGC
ACGACGGGTTGTTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTACGAGTATCA
CGATGTACCGACTGCGGGGCATCCGGGCCGTGAGAAGACGTACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCAGTACAAATGGGTGCGCAAGTAC
GTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTGGCAGTCCATGT
CTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGT
ACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTTAAACGCCATGGCATGCCGATCGACATTGTGTCGGATCGAGTCCCG
CGCTTCAGTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGATCATCCGCAGACGGACGGGCAGACCGAGC
GCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTTACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTCGCCACCAACAACTC
GGTGCATGCCTCGACCGGGTATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGG
GGAGGATCTACGACTGCAACGCAGCAGTCGCAGAATGCCGCTAACACTTGCACAGTGCCAGCCGCGACTACGCGCAACAAGAAGAAGAAGCACGCGTCTG
TGCAGGGCACAGACGTCGACAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGC
TAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAAATTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTC
GACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAACTCAAAACCTGCCTAAAC
ATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATTGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCC
ATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTTAAGCCATACCTGCCGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGCCCCAG
CGGGAGCGAACCTCTGCTCCAGCGCGTAAACGCGCTGGGCCAAGCGTGCGACGCAACCTCCCACGACGACAGAGATGTCCGACGCGGTCTGCGAGGCCTG
AGCGACTTGAGCCCTCAGGATCGCCACCGCCTGCATCAGAGCGGCGAACTCCCGGATCTGATGCTGTTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGG
CCAAGGTCAACCCCTGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCTGCGGCTCAACACGCTGGATTGTTGAGCGT
ATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGA