Description :
From Genome Similarity Track
Location :
Scaffold_3791:3- 2076
Sequence
2073 bases(100 bases per row)
GGTTACAAGGACGTTTGGGGCAGTGAGCAGCTTTACGCTCACGTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGCAAGACGAGATCCTGGCAGTCTT
GGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCTGACG
GTACAGGTGGATGAGGATCTGTACGTCGTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGAGCGTACAGTGCAATACTGTGGAGACTACCTG
GATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATGTACTAAAGGG
ACAAGATCCGAAAGGGCTGGTGATTGGTGGAGATTCAAATTTGTGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCTCTAACACTGTT
ACGGCAGAAAGTGATGATCCACCTGCGTGGGTGAATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGTCAGTGCC
GCTTTACGGAATCAATGTGGTGTCGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGCTGAGCCGACTAGACGAAGTGGTGGTAGTTGGATCCG
AGAAAAAGGACAGTCCAGGTGATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATTATCGAGGAAACATTTGTGAAGGGAGTCCGCA
TTGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAA
ATCTCACGGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGA
TTGATGAGATTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGTATTGGTCGGACCTACC
AACGGATCCGGGAATGTTTCCACTGGAGGGACTATTTAAGAGCCTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACA
ATCGAAGGGGAGTCGCCTGGGAATGTCCACCCTTTCCAAATCATTGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGT
TGATTTAAGTGGACCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCATCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGTGTTTTCCG
AAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCTTGGGGCAGCGACAGCGA
GCAACCATGACATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGATGTATCCAGGATTTGGATCAGAGG
GATTGGGATGAGTGCGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAAACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATC
CCAAATCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCA
AGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGGATCGATACAACGAAGATGCCCGTCCACATCAAATCCAAGTGGGATC
GCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCTCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGGA
CATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCTGTTCCTGTAGTACACGTATCCAAGCTGAAGTTG