Description :
From Genome Similarity Track
Location :
Scaffold_1286:3- 2050
Transcript NameFunction/comments
Physo_145460reverse transcriptase

Sequence
2047 bases(100 bases per row)
TGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGGGACGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTC
GGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTG
CGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGACCGACATTGTATCGTATCGAGACCCGCGCTTCACTGCACACCT
TTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGATCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTC
GTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCG
GGCATACACCGTTCTACATGAATGCCATCAGGCACCCACGCCTCCCCAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGC
AACACAGCAGCCGCAGAATGCCGCTGACACTAGCACAGTGTCAGCCGCGACTACGCGCAAGAAGACCAAGAAGCACGCGTCTGTGCAGGACACAGACGCC
GACAAGAGCAAAAAAAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGATCTACTGCTAGAAACGAGCTGAACG
AGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTGATCGACAGAAGCTGAA
CGCAGACAATGTTGGCAGGGGCAACACAAATGAATTCAAGAAGGGTTCATTAGTCTTGTTAGCTACTCAAAACTTGCCTAAACATGCCGTTTCCGACTTC
GGGGCAAGCAAGCTTGCTCCGCGCTTCATCGGGCCGTTCACTGTGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN