Description :
From Genome Similarity Track
Location :
Scaffold_2645:3- 2039
Sequence
2036 bases(100 bases per row)
ATCCACCAAGACTTACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGG
AAGGATGGTCGGTGCCCTCTGAAGGTGGATCTAGTAGCCACGGCTAACGAGGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTTTCGAGTTCG
GATCCAAGGAGGGAGGATTCCGCCTGGAGGGACCTGGATCCAGGGTATAGGGTTGATGGATACAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCAC
AGACGGTTGCGATATGATGTTGGTTGATGGGAGAGCTCAGATCGACGACGAGTGCGAACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGT
GTACCCATAATAGGGTGACCATGATGATTACGTCATGGATCCGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGAAAATAGGGACATGCAG
CCGAGCCTGGTAAGGGATTTAACAAGTAAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAGTATCAATACAGTCCTCAATTTGCACAGTAA
CACGCAAGTGCCTTCCTCCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTAGAAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACAG
GATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTCCTTTACACGTGCAGATCCGACAGGTTAACCGTATTTACTACTTGGTCGGTTACACCCTAG
AGGCTCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTATGACGTAAAGGAAACGCAAAGGCAAGGGACACACCCGAGAGGCAACCCTACGGCCAG
ATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGTTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCC
CATCCCCACGTCTCGCCAAGACACTCAAGCTTCGCCACTGGAACTCTTCGGAGGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTG
AGAAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGT
TGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAG
GGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGTAGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAG
AGAGGTGGATCTGGATCTAAAGGAGAAACCTCTCTATCCTCCCCACGACTCCTCGGGGACCCCTGCGGATCTTGACCCAAGTCAAGATCCGCTAACGAAA
CAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGCTTAAGTCAGCACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGA
AGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGCCCAAGCTGGATCTAGGTCAAGCTGGTCCGACAAGGATCTCGA
GTTTGTGTATCGCCACCAAGCTTTACGCGACTTTCTGCATCAAGATCACGTCATGCGGATCCGGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTG
AGAGCACCAGCGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACCGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGA
ATATCTTCGAGCTAGACTTGCATCTCATAGTGTCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGCCCATCACCGGAGAAAGGTCGCGCACTATGGATCC
AGTGCCGTCACCGAGGATCAGCCAAGCTGCGTCCTC