Description :
From Genome Similarity Track
Location :
Scaffold_118:3- 20349
Transcript NameFunction/comments
g6180.t1hypothetical protein
g6181.t1hypothetical protein

Sequence
20346 bases(100 bases per row)
CTTAGATTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGAGAGTAGCACACTTTCAACACCAGCAGTAGC
GCTAAGACCTCCTTCTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCAGCCACAAAATCGAACCGGGTGCAACTTGTCATCATGGTATTGCA
TCAAAGTGGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGAATCGGTGCCTCTGCAACCTTCTG
TTGGAGCGCGGCGAAGCTTCGTTTGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAA
TCCTGGATGAATCGACTGTAATAATTCAGCGCACCGAGGAAAGATTGCATCCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCT
TGGTGTCGGCTCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATAATCTTCGTAAAGCTCACACTAATGCGACA
TTCGGTGAACCGTCGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGCCGGTCGAAC
ACCGGCACCAACAAGGATTCATCCGGTTCTCCGGTTGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATT
CGCGGTCGGCCTCGAATTTGGTCACCCGAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTC
GGCCGTTCGCATAAGCTCCGAAAAGCGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCA
TTCTTCAACCCAAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGA
ATCCACTGGCCGCATCAAGTGAGCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCAC
TGCATTCACCAGCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGACTGTCTGAAAACGCC
ACTAGACGAGCTTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTCCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCT
GTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAACACCGCAACGAGACT
TTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCAGTCAGGTCCGGTAAGAACGCCAAC
TCGTGTGCATAGTCCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGTGGTAATCTCAT
GCATCATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTCCTCTTCACTCGTATACGTGGTATCCGCGCCATC
AGAGGTGTCGGTCGCCACCGAGTCGTCATCTTCGTCGACCCAACTACCTCCAACGGGTTCGTCAGAGGATCGCATCGTAAGTCGTCAACGGCATTCGGTC
TCGTTCTGTCGGTTCCTCAGTACTCCTATCTGCGAACGTTATCTGGCCCTCGTCTAGGCCTCCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGT
GTCGGATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCG
CGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCTCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGA
TTCGTTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTT
TCCAATCCGGCGTGCCCACACATCATGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCAACAAATCTTCG
GTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTGC
CGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTC
GTACACGCGCTCCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGA
TCTGGAACTTCGCGCAAGCGCAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTA
CAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATTGTCTGGCC
GAGGTCTCGGGATGGATGGTCGATTTTGGCCATGCTGAGGATCGAAGCGTCGGTTAGCTCCACTTCGTCTCCGTCCACACGTCGTCCATTCACTTCACTC
TCACCGAGGCTTACGCCTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACA
TATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAG
ACGAGTTCCTGCAACTCCGGCGAGAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAA
CCTGTTTGCACATCTTGCATCGCTTAAAGCAGTAGTGAGCCGAATGGGTGAGTCCCCCGCAGGCGGCGCATGGACCATATTGGCGTCGACTATCGCGTCC
GGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGGCGTTGACCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGCTCCTTCGGCCGCA
TTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGC
CAGAGTGAGACTCCGGCCCATACTCCTTGGTGTCATCATATCCGTCGTTGTACGCTTCTGGGTATCCTCCACGCGCGTCCACCGAGCGTCCCGCATTCAG
TGCTGTCACTATGTTGGTCAGTGCATCAGTGAGAGTGACCCTCGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCT
CTCGGTGACGTCGGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGA
GGACTCGCGTCCAGATTTTCGCTCCCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCT
TCTAGACCTCGGTCTTCGCACGAATCCAAGAAATGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGC
CGTTAAGTCGGTTGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTA
CTTAATGAACGCATCGCTCAACAATTTCCACGTGCGCCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAAC
GCCATGCACCATTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTGTCGCGGAGTCCCA
AGTACGGCTTGATATTTCCGAGTGGGAGATGCGTAGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACAGCGCTCAGCTCACGAATTTGGCGTGC
CCATTCTCCCGTCAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTT
GCGCTTCGTCCAGCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTCGGCGTCACCATGTGAGAGTCTT
GGAAATACGTCGACGTCGCACCTTGGGCCGAAAATATTCCGGCCTCGGTCGACCCTCTGGGGCGTCTCCCAGGGGTCACTGGCAACGGAATCATGGACGG
GTCGACCGGATCCGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGC
GCCGTAGCGGCGTCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCT
CGGCCACCTGCCGAGTGTTCCACGCCTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCG
CATCCAATTGCTCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGC
CGAGAATTCGCATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACT
CTTCGGTGAGGTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAG
GTCATCTTCTTCGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCG
AACGACGAACCGGAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTC
TTCTTCTCTTCTTTCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGT
TGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAAC
ACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCA
CGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAG
GGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCCTAACTCTCGGCCACTCC
TATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAG
CTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCTACAGCTCTGGAAGCTCTGTAGGTC
ATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACG
AAATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAAT
GAGACCCGCCAATCAAGACGCTCTGTCGCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAACCCAACGCCACATGACCAA
GCGATTGAAAGTCGCTGGGGCATTTGATAGGCCCTGTGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGGGTGCTCACCGCCGTGAGCGGGATGTCG
CGCTTGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGCAGCCCGCCATGTTGTTCAACAACACATCCTTGCGGGGAA
TGGGTGTCTGGGCGGGCACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACTTCCCGTTCGGCTTGCGAACGCAGAAGGTGGGCGTCGA
GTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAATGACCTTGCACTGTTCGCGAGGCAGTGGCCATTGCCTG
GTCACACAGTACTTTGTGCCTGGCACAAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGAGTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGA
ACTCCTTCACCAAAGGATACACTGGATCCTTGGGGTTCTCGAGGATCGCAGAGCCCGTGCGCGTTGCGCGCTTCTTGCCAAGCTCGTCCAGGACATCCTT
GTCCATAACGGAAGAGGAGCTCAGCTCTTCTGGAGAGGCCTCCGGCTTCAGGAGCACCATCTCCGCGATTGCCTCGGCTTTCAGTTGTGCCAGGAAATCG
TCCATCGACATTTCCTCGAGGTTCAGTAGCTCTGACACCTCAGGCAGGGCTGCCAACGTTGTGGAGCCCACCTTGACCGTACACCCGGTCTCGCCGTCGA
AGAAGTGATAGCATTCTTCGGCCGGCCGTGCCTGAGGAGAGTTCTCTCTCTCCGAGTCGCTTGTAGCGACTCCAGTCTGTCTCACCAGACTCGGCTTACG
GCGGCGACGACGTCGTCGATGCCCACCACGGCATGGTCCTTTGTTACCCACAGCCGGTGGTGACTCAAGGGTGGAGTCGGGAGTTCCATCGACTCCGTGT
GGCACATTGTTACCCACACCAGAGGTGCTCCCAGCAACCTCGACCCTGGCCACGGTCTCGACCTCCTTGGTCTCACGTGGGCTCGTTTCCCTTGGGGAGT
TGACTTTCCCCGGCGTCGATAAGGCCGAAGGCCGTACGGTGCCATAGTCAGGAGCGGTGGGTACCGCTGTCATTGCAGTTCCCCTCGCTGGACTCGACGT
CCTGTCCACCGGCATTGCCTGTGGCGGTCCGTTGCCCGCGGTGGACGGTGTCATGACACCTGTTGCGGCTCCTGCCGCAACTAATTCTTCGGAGTCATTT
CCGACTCGGCTCCGGTGGTAGGCCCGGCTGCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCAGTAGCAGCAGGCCGGCTAGCCCCGATGGCTT
TGCCGCGCCAGTCTATCCAGGGCTCATGCTTCTCAAGCCATGGCATGCCCAGGATCAAGTCGTACTTGTCCATATCAAGAACGAGGAATCGTTCAGTGGA
ATTAAAGTCCTCAAACTTGACGGACAGGTCCATAAAGACCTTGGGCACCTCCACTACAGTCCCGTCAGCCAGTCTGACTAGGACATGCCCGTTCCCTTTA
CTTTCTCGTAAAGCATCGGTGAACTGGTCGCTCTTGCGAGCGACCGTCCGGCGGCGTGCAAAGTTCTTTGACGCCCCAGAATCGATCAAGATTCTCATGG
GATGGTCGTATCCCCGTACACTTGCATGTACTACAAGCATCCCTCCGCTGCCCTTCTCCGCTTCGAGAGTACAGAGACTCTCAGGGGCTAAGCCTTCATG
GTGCGCACCACCCGCGCACCACTCATGAAGACTTAGATCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGGCCACGGGGTCGCG
GCTTTTGCCAGCGACCCCAAGGACCAAAGGGCTTGGGAGGAAACCGCCGTGTTGTTCCTCCCGCGGGGCACGCACGTTTCATGTGCCCCAGTTTGCCACA
GCCGAAACAGCGAATGTCGTGCTGTTCGGCAAGGCTCAGGTCCATCGGCACAGGACCGTTGAAGGGGCCTCTACTTTGGGGCCCGCCCTGAGTGGAGCCC
CCAAGCCACGCAGTGGCAGGAGTGCGAGCCTGTCGATGGCTGTACTCCTCCTGAAGAGCGATTTGAATCGCTTCTTCCAGGGTGCTTGCTTGCACCCGAA
ACAGCTGCGTGCGCGCTGGGCCTACTCGCAGGCCGTCCATGAACACCGTCACCTTGATGTGTTCATGGAGTGGGTTTCCCACCAGAGATGCGGTGAGCTC
CCGCATCTCCTGGATGTACTCGTGCAGCTCACGTCTCCCTTGCTTGCACGCAAGGAAGCGTGAGCGCTGGCGATACTCATAGTTCGCCGGGAGGAAGGCG
GCTCGAAGCTGTTCACACAGCTGAGTGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCG
AAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCA
ACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAG
TCACGCTCAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTG
TCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCG
AGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCT
ACAGCCCTGGAATTCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGC
TCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTT
CCTAGGTCACTATAGCGCGGTAAATGAGACCAGCCAATCAAGACACTCTGTCGCCGTTCACTGAAAGGTGCAACGTCCGCCGGACCTTGACTGTTCGGCT
CCAAAACCCAACGCCACAACTGCCCCCGCCTCGACGCAAGCTCCCGCAAGTAGTGCGCGTCGCGGCGCCTCTTGATCGCACCCCGATGGCTCGCCGCTCG
CCGTTGCTGAGCCGAGCTACGGCCGCCGCTCCTCATGCTCTCGACACCTCCGAAGAGGTTCGTTTCCTGTCTCTCTTTCCGTCTTCATGCTCCTCGAACC
TTGTTTGACCGCCTCCACGTTCACAGGAAGCTAGCGGCACTCCGTCCGCTACTTCTGGCTCCGCTTGAGCATCGGTGACCGTTCCTCGGTCGCCGGCTGC
CACTCCTCTGGCTGCGGGCGAGGGTGCAGAGGGTTCGTCCCCACCCACGCCTCCGTCGGCTTTGGTGACGACCCCATTGGCTGCCCAAGATTCTGTCGCT
CGTGTCCCCGATCAGCCGAGCGTGGAGGAGAAAGGTGAAGACACTTCCGAGCATTCTCGAAGTCGCACTCCCGCTTCGGCAGCAGACAGCGAGTTGGCCG
CTCTTCAAGGGTCGAATTTGGATGTTTTGGCCGACATCGCGTCGACACCTGAGGTCTAGGCTTCGGTCTGGCCTCATCCATTTTCCACGTTCGTTCCTCA
AGCTGCCAGTGTGCCGTCCGAAGCCTGTAGTCCTCCGTAGCGGCAGTTCTTGAGCTCCAAGTAATTCCATTTAATCCAATTCCATTTGAAAATCGTTCAC
GTCACATGTAAATATGCAAATTCGATGCAGTAGCAGTTTTCGTCTGTCACTGCGGGCTGCATCATCCCCGCAGGCAGTTCATTCGTCAACCGACGTCGCC
ACCAGGCCTTGTCAGAGGCTTGGTAGCAATCAATAGTCGGTCACTCGCAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCC
GTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGCGACTTGAACCATCTGCAATCGTCGTTCACTGCGCCGAGTCCGCAGATAATCAT
AAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGCTCATTATACCCAATCCACTTCACCTTGAACTCTCGGACAGCGCGGCTAGTGCC
CGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCG
AAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTTCGGTCGGTCTCCAAATTCGTCGACAGCCTTGAGTCGGGACACGTGCACCACCG
GGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCAAACTCTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAG
TTTCTTGGTCAACCCTGGCTTGACTCGCTCCATATACAACCAAACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGGTCAAACGTT
GCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGACATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCG
CCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTG
GCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCA
TCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCG
TCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTC
GCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTA
GTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGA
AATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCA
GGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCC
AACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGT
TCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTTAGGTCTGTTTCCTT
GCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACG
TCTTCTGCGTTTGGAGCGCCAGGGTCGCCCTCGTTGCTCGATTGCTCGGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCT
CAGCCGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGTTTCTTCCTCACTTTTGCTTGGTTTCTGGTTGTTGCAGTTAGGTAGTC
GGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATCCCACGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTG
GTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGC
TGAGAGCCTCGCTTGCCAACGAGTCTGCTGCAGCGTTGAATTCTCGGACCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGCTCTCGGTGTCG
ATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCT
CCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAG
TCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAATCCGGTATAG
GACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCA
CGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAA
GTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAG
CACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGT
GCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAG
GATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCGGCGAAGCTTCGTTTGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTAC
AAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCCTTTTTTGAAGCAGGGAATGGCA
GCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTT
CGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCA
TCGACAAACGACCGCCGGTCGAACACCGGCACCAACAAGGATTCATCCGGTTCTCCGGTTGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCA
CTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGTCACCCGAGTTGTTGACTCCTCGAGTCGTCGCGATGAAGGGTCGGTCACCCCTGT
CCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAGAAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATC
ATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCGAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCC
GCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGAGCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCAT
GGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGAC
GCCCATGGACTGTCTGAAAACGCCACTAGACGAGCTTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTCCTCCGAGCTC
TCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTG
TCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCG
GTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCCACTACCTG
AACCGTCCCCCGCGGTAATCTCATGCATCATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGATCTCTTCACT
CGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACC
GAAGTCGTCAACGGCATTCGGTCTCGTTCTGTCGGTTCCTCAGTGCCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTCCCAAGTCGTCGGATGG
TCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGTGAAC
AAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCT
TTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCT
CGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACATCATGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGC
CCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCATTACCT
CATCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATC
CATAACCCATACTTCAAATTCGTACACACGCTCCCAGCCTAGCGTGATTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGC
ACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAACCGTTTCGCGTATGACGCGGAGATCACACTGACATTCGCTCCAGTGTCCAGCAGAA
TCCTCGTACGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGA
TAACAGTTTAATTGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTTCGTCTCCGTCCACA
CGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGC
TCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCC
TAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTT
CACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATA
TTGGCGTCGACTATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGGCGTTGACCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGA
GCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTT
CGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCCTTGGTGTCATCATATCCGTCGTTGTACGCTTCTGGGTATCCTCCACGCGCGTC
CACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCATCAGTGAGAGTGACCCTCGGTCGATATTGTTGGTCATCCCGGCGACGGTTATCG
TCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGC
GTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCAGATTTTCGCTCCCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTG
AATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCTTCACACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCA
TGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGTTGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAG
CCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGCATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCA
ATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCATTCGTTAGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCAC
TGCATGGACTTCTCGCTCTTGTCGCGGAGTCCCAAGTACGGCTTGATATTTCCGAGTGGGAGATGCGTAGCGATCTCTAGCCTCGGTGTCGCACTGTCAT
TCTCCACAGCGCTCAGCTCACGAATTTGGCATGCCCATTCTCCCGTCAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATC
GCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCACTTCGTCCAGCAGTCGGAGCGGTTCGATACCCCTCGGCCTCTCTCGCCAGTCGTTCTGTGCGA
CTGACCGACCTCGGCGTCACCATGTGAGAGTCTTGGAAATATGTCGACGTCGCACCTTGGGCTGAAAATATTCCGGCCTCGGTCGACCCTCTGGGGCGTC
TCCCAGGGGTCACCGGCAACGGAATCATGGACGGGTCGACCGGATCCGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAA
GGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCA
CATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTGTTCCACGCCTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGA
TGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAATTGCTCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGT
GTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCG
TTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTT
CCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACG
CTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCGGAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGT
ACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTTTCTTCTCTCGACTGCTCGTTAAGGTAAGAACCTGTATGCAACCAAGACACACA
GAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCT
TCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGA
GTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGG
TACCGGCAGTCACGCTCAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGA
CACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCC
ACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTC
TCTTATCCTACAGCTCTGGAAGTCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGT
ATAGCCGGCTCTACACAGCCGAGGGTACGACACCGAAGTGGGTACAAACGAGGTTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGT
CACTATTGTTCCTAGGTCACTATAGCGCGGTAAATGAGACCAGCCAATCAAGACACTCTGTCGCCGTTCACTGAAAGGTGCAACGTCCGCCGGACCTTGA
CTGTTCGGCTCCAAAACCCAACGCCACATGAGCCCAGGATGCAAAGCATCCAGGCGTTGTCGCTTCACGCGTATACGCCCAGCTCTTTGCTCGACCACTA
AGGTGAGAGAGAGCAAAAGCGACGCGGAGTCGCTCGTCCGAGACGA