Description :
From Genome Similarity Track
Location :
Scaffold_2677:3- 1992
Sequence
1989 bases(100 bases per row)
ATAAAGTCTATTAAAATTGGAATTCTTATGTGCGGGGGGCTATTTATGGGATTAAATTAGTGATTGCCAGCATTGATTGCTTCATTACCAAGTTAGTTTT
CCCGTTTTGGCGGAAACAAGACCGGATTAATTTTTAGGACCTATTTTTTGGTTGATGCGAGTCTTTAAAACAAAACACTTTCCAGTGAAGTAGTTCTAGA
AGACGTTGTGATACCGTCGACCGCTGATCACCAGATTAAGGCAGTTACGTCTCCCTTCGGTCTGATATCTAGACGGCAGTCATTTCGCATTTTCCTTTCA
ATACCTCAAGATCCTCCTTTCCTGCGGAATTCCTCTCCACAGTCATGCGCAGTATACTCTACGTCACTCTTGCCTTCGCGGTATTAGCTCACAGCAGCGT
CGTCGCAGAATTCCTGAAACCCGATGAGCCTCGGTCTCAGTTCTTGTCGAAGGCATCAACTAAACTTTGAGGTCAGCTGATCTCTTCGGGTTGCAGCCCA
AGAAGTTGTCCGGAGCGGCCGCCCCAACGACGGGTATGGAGGGATCTGGAAAGCTGCTACCCAGGGTACCAGCAAAGTCGTCAAGAACCCCGACATTGAT
ATAGCAAGCTCATCGAGTTGGCCAAGAAGGCAAAGAAGCTGAAAAAGTTGGCTAAGCCCTCACCATTGTAGATAAACCGGTGAAGTTGCAGCTACCTCCT
TTCAGCTTTAAATAATTGTTCAATTTAACACAAGACCTTTGAACAACTAAAAAACATTTGCAAGTGTGGTCGTGATGGAAACATCACCGCGTTAAAGCAA
GCATCTAAAACTCTGCTTTCGTACTAGAAATAATTTTCGCCTCCAATCCCTCCTTGGAAACTCGATGGTCTAAGAAATCCACCTTGCGCATCCCCCAATA
GCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTTTTTCGCACAACTGATCCCACGATTTCGCCGGGATAGAA
TGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGTA
CCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCC
GGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGA
ACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGACGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCA
ATGCACAGACGTATATTCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGTCCCACGGGGACGTCGAGAAAACTGATGATCTTGGCTTGCAGCAG
GCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACCGAGGTGCCACCTTCCGCACTCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTG
ACTCCGCGGGCAGCGGGCGGTAAACGCATTACCTTTATCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCA
TTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTTTGGTCAGTGGTACCTACGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGT
GTAGATCACCGCCTTCATGGTAACAAACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGGCAGTCC
TTCTGTCTTTGGGGAATCAGGTACCGTGGTATCAGGGAAACCAACAGCTGGATCTAGTCGGTCCTTTAACGAGTTTAAGCCCGACGGTT