Description :
From Genome Similarity Track
Location :
Scaffold_1308:3- 1972
Transcript NameFunction/comments
Phyin_T30-4PITG_22121Putative uncharacterized protein

Sequence
1969 bases(100 bases per row)
CATCTCTCTCTGCCTCCGCTTGTATCACTGTCTCTCACCCGACGTTACAGCAAGCTAGGCGGTGATATAATACAAGAGGAGTATGCGGTGAAGTGCAGGG
GCTTCGTTGCTAGTGGCCGGAGGCAACGAGTGACGAGAAGGAGTGACAGTAAGCGGGGTTGCATGCAGGGAAATCTACCTGTACACACGGTGTCGCCATT
GGGCGGAACATCCGTCTGAGAATTGAAGATATCAGACAGGTTTTGGCCAATCATAGACAGCTTTGAATAGTCTGGGATCCAGGTTTTTGCCAGGGTGGAA
TTGAGCTTTTTTGTTTTTTGTAACGCGTAACCTCTACCCGTAAATCCCCAAAAATGCGTCCCAAGAAAGGGGGGGTTAAAATTGGGCCCGGCCCAACGGC
TTAATTTTAATACGCGGGAAAAAAAGCCATTTCTCTGCGCCAAAGACCCCTCTCCCTCGAATTGATAATGGCTATGAGCTCTAAAACCTCGGCTCCTCAA
AAGCTCGTCCGAGGCTTGCGTGCTATTAATACTACTCGTTGGAAGATTTGAAAACACTCCAAAATCATCCGTTTTAATGGATACACGAGAAAATCATCCG
TTTTACCCTAGATTATAATCCGTAACCAGGACAGATGCTGAAAGATTCAGAGCAAGTTTCATCGTCCTCAGAGCAACTTTGTTCAGCTGGTTTGGCCAAG
TTTGTAGTGATCACCCTGAAACTCGAGCTCTTCTTCACAGAATTCATGTTATCCTTGCTTCTGGTTCATGCTAAATAATTCACGTTTTCTGTGGCGTACG
AAAATCTGGTCCGTACAGATGCTCCAGGTAGAGCGTTCTTCTCGCTGGGCAGAGCACTTGGAAGTCGGCAAATGGACAGCTCAACAGCGGGAACACGTAG
TAACGCGGAATGAGAAGATGTTTGGCGTACCGATCGATCTGTAGACACTTTGAACACGCATGCCAGCAACTTGACGGGTGAGTGCCTAGCATTTCGACAC
CATTGGCTTCTGAGTCGGTGAACACAAACACATCCACATAGAACCCGTAGGCTTTGTCCACAAGTCGAGCGGGGATATTCCAGTCACGGTCTCGTGCTAC
ATGGATGTTGCTGTCGTACACTTGGAGTTCATAACCCTCTGGAACGGCCCACCGACTATTTCGAAGCAGCTCGTAGCCTTCCAGGGTCATGCCAAAATCG
GCGTCATCGTCCCAAGGAATGACAGATTGAGCACGAAACTGCCCCAACAAGGTGCCGCTGTCAAGCCAATAGTCGACATCGCGCTTGTTGAGCATTGCAC
TGAAGGCACGCACGAGGTCTGTGATGGACTTGGTGCGCTTACGAGCAGTGACACAAACTTCCGGGCGATAGTAGTGGGCATCGATGTGGCCTTCAAGCTC
CGCGCACCAAAAACTACGAGCTCCATTAGGCAGACCACGCATTAGAGCATGATCAGACTCCGCAAGCTCGGAAAGCAGCCACCAACACAGCGATGAGATG
AGCATCGACGCCAAAGTACCCGCTGTCCATCGAGAATGTAGCAAGTCACGCAATGCTGGTCTCCACACCGTCATGAATCGATGCATTCCAATAATTTGTT
TAGACATCGATGATAAGTCGCTGGATATTCCACACCACGCGCAATTGGTGTCAAGTCGCCGTCTTGCGTTCCACCGGTGTGCAGTATAAATTCTAGGGAT
CGCGCTTCAAATCCCTGGCTACAGGAATTATCTTATCTGAGTGGATGTCCACTCAGATTTTTCCCAAAGCAGCTTTTCCTATCCCAAATATTACACTAAC
AGTTTTATTTAGATAAGAAGTCCCGTGAAAAATCTGAGTGGGCATCCACTCAGATAAGATTATTCCGTACAAGCTACCGTACCTGTGACGGGGTCACACA
GCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATATAAACTCTCAGTGAACGGCAGTTCACAGGTA